Information

Warum erhalte ich Übergänge von Cytosin zu Guanin/Adenin in mit Bisulfit behandelten Sequenzen?

Warum erhalte ich Übergänge von Cytosin zu Guanin/Adenin in mit Bisulfit behandelten Sequenzen?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe meine Sequenzierungsergebnisse erhalten (mit Bisulfit behandelte und nicht behandelte Sequenzen derselben Spezies Allium cepa) und jetzt muss ich die Analyse im Cymate-Online-Tool durchführen. Ich habe alle Sequenzen so vorbereitet, wie sie im Original-Cymate-Papier geschrieben sind (Mastersequenz und Klone - ausgerichtet in ClustalW, stumpfes Ende).

Mein Problem ist, dass ich Ergebnislücken (Bild ist angehängt, es ist von Cymate Result) auf den Positionen 27, 50, 58 usw. Als ich meine ursprüngliche Ausrichtungs-FASTA-Datei ansah und diese Positionen verglich, bemerkte ich, dass diese Lücken von C nach A oder C nach G Übergänge sind (und offensichtlich gibt Cymate nur C nach C und C nach T Fälle aus).

Weiß jemand, warum ich diese C zu A oder C zu G bekomme, sind das einige Nichtübereinstimmungen, sollte ich sie manuell aus der Ausrichtung entfernen oder habe ich einen anderen Fehler gemacht?

Jeder Rat von Ihnen wäre sehr nützlich für mich!

Mein FASTA-Datei-Alignment, das ich auf Cymate hochgeladen habe, ist hier (falls jemand überprüfen möchte). Die erste Sequenz ist die Mastersequenz (unbehandelte, ursprüngliche Sequenz) und der Rest sind Klone (mit Bisulfit behandelte Sequenzen).

Consensus_cepa __ (289_bp) GAAAGCCAACCACCACATCCGCCATCCCTCACAGTATGCCAACGAGCAGCTGAATGACTCCGAACAACGCAAAGCATGACGCCCAAACCGACGAACACCCAACCGAAAGGCCACAAGCGCAACGTGCATTCCAAAACCCCATGAACCACCGAATCCTGCAATGCACACCACGCTCGACGCCATTCGCTACAGACCACATCGACACGAGCGCCAAGCCATCCATCACCCGAAGCCATCCACCCACTCACAAACATACCACGAAGCACAGCAAATATGAAGACAAACCCTC MV_A_SP6_izrezani_s_primerima __ (295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATAACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGAAATTCTGCAATTCACACCAAA - TATTGCATTTCGCTACGTTCTTCATCGACACGAAAACCAAAATATCCATTGCCAAAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC MV_B_SP6_izrezani_s_primerima __ (295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATGACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATGACCTTGAACGCAACTTACATTCAAAAACTCGATGATTCACGGAATTCTGCAATTCACACCAAA - TATCACATTTCGCTACGTTCTTCATCAACACGAAAACCAAAATATCCATTACCAGAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC MV_C_SP6_izrezani_s_prime rima__(291_bp) AAAATCAATCCACATCCGCCATCACTCACAGTATATTTAC-AGTAAATAAATAA-TTAAAATAACGCAAAACATGACACCCAAACAGACATACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGGAATTATATCTGCAATTCACACCATTACCAGACGACATGACCATTATCTGCAATTCACACCATTACCAGACGACATGACCATGACATTACCAGACGACATGACATGACCATTACCAGACGACATGACATGACCATTACCAGACGACATGACCATGACATTACCAGACGACATGA


Ich habe Ihre Sequenzen schnell ausgerichtet, und soweit ich das beurteilen kann, lautet die Antwort, dass Ihre "Konsens" -Sequenz schlecht zu den 3 anderen Sequenzen passt:

CLUSTAL Formatausrichtung durch MAFFT L-INS-i (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-tt MV_C_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtaaataaataa-tt MV_B_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-tt. *** ... ***. * ***** ********* **********… ** **.*. *.***.* *. Consensus_cepa_ cgaacaacgcaaagcatgacgcccaaaccgacgaacacccaaccgaaaggccacaagcgc MV_A_SP6_izreza aaaataacgcaaaacataacgcccaaacagacgtactctcaacctaataacctcgaacgc MV_C_SP6_izreza aaaataacgcaaaacatgacacccaaacagacatactctcaacctaataacctcgaacgc MV_B_SP6_izreza aaaatgacgcaaaacataacgcccaaacagacgtactctcaacctaatgaccttgaacgc. ** ... *******. ***. **. ******* ***. ** *. ***** ** ... ** ... *. *** Consensus_cepa_ aacgtgcattccaaaaccccatgaaccaccgaatcctgcaatgcacaccacgctcgacgc MV_A_SP6_izreza aacttacattcaaaaactcgataattcacgaaattctgcaattcacaccaaatattgcat MV_C_SP6_izreza aacttacattcaaaaactcgataattcacggaattctgcaattcacaccaaatatcgcat MV_B_SP6_izreza aacttacattcaaaaactcgatgattcacggaattctgcaattcacaccaaatatcacat *** *. ***** *****. * **. *. ***. ***. ******* ******* ... * ... Consensus_cepa_ cattcgctacagaccacatcgacacgagcgccaagccatccatcacccgaagccatccac MV_A_SP6_izreza --ttcgctacgttcttcatcgacacgaaaaccaaaatatccattgccaaaaatcattcag MV_C_SP6_izreza --ttcgctacgttcttcatcgacacgagaaccaaaatatccattgccagaaatcattcag MV_B_SP6_izreza --ttcgctacgttcttcatcaacacgaaaaccaaaatatccattaccagaaatcattcag ********. *. ****. ****** ... **** ... ****** ... **. ** ... ***. ** Consensus_cepa_ ccactcacaaacataccacgaagcacagcaaatatgaagacaaaccctc MV_A_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc MV_C_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc MV_B_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc *.***** .* *** ***.**.**** **** **.* .******… **

Ich würde vorschlagen, zu versuchen, eine andere, geeignetere Konsens-/Referenzsequenz zu finden. Dieser scheint nicht angemessen zu sein.

Zugegeben, ich habe keine Ahnung, wie Sie auf diese Konsensussequenz gekommen sind (sie ist sicherlich kein Konsens der anderen Sequenzen, die Sie zeigen), und möglicherweise passiert noch etwas anderes, das ich nicht verstehe.

Mit dem Bisulfit-Umsatz scheint dies nichts zu tun zu haben, da die Daten auch Veränderungen beinhalten, die nicht auf Bisulfit zurückzuführen sind, Lücken etc.

Es wäre hilfreich, mehr über den gesamten Workflow zu wissen.

AKTUALISIEREN

Auch wenn ich mit dem Arbeitsablauf nicht vertraut bin, könnten solche Lücken nicht mit der Methylierung am Gegenstrang zusammenhängen? Z.B. CGTA --> TACG.

Gibt es einen bestimmten Methylierungskontext, den Sie betrachten? Nur CpGs?

In einigen Fällen werden seltsame Varianten unterstützt (z. B. Konsens ist keine Fremdgruppe).

Wenn es sich um Sanger-Daten handelt, ist es immer eine gute Idee, Spuren direkt zu untersuchen.


Kapitel 18: DNA-Mutation und -Reparatur

- Stille Mutation: Ändert ein Codon in ein synonymes Codon, das dieselbe Aminosäure spezifiziert, wobei die DNA-Sequenz verändert wird, ohne die Aminosäuresequenz zu ändern:
* es gibt einige phänotypische Effekte, darunter:
- tRNA wird für verschiedene Synonyme Codon verwendet (beeinflusst die Geschwindigkeit der Proteinsynthese)
- Exon-Intron-Übergänge, die das Spleißen beeinflussen
- Bindung von miRNAs an komplementäre Sequenzen in mRNA, die bestimmen, ob mRNA translatiert wird
- Neutrale Mutation: eine fehlende Mutation, die die Aminosäuresequenz des Proteins verändert, aber seine Funktion nicht signifikant ändert

- Salpetersäure: desaminiert Cytosin und erzeugt Uracil
- Übergangsmutation

3 Nonsense-Codons: UGA UAA & UAG

GGA (für Gly) würde zu einem Nonsense-Codon mutiert, das ein U durch ein G . ersetzt
GGA>> UGA

b) Wenn eine einzelne Transversion in einem Codon auftritt, das Phe spezifiziert, welche Aminosäuren
kann durch die mutierte Sequenz spezifiziert werden?

c) Wenn ein einzelner Übergang in einem Codon auftritt, das Leu spezifiziert, welche Aminosäuren können
durch die mutierte Sequenz spezifiziert werden?

UUU: CUU(Leu) UCU(Ser) UUC(Phe)
UUC: CUC(Ser) UCC(Ser) UUU(Phe)

b) UUU: AUU (Ile), UAU (Tyr), UUA (Leu), GUU (Val), UGU (Cys), UUG (Leu)

UUC: AUC (Ile), UAC (Tyr), UUA (Leu), GUC (Val), UGC (Cys),
UUG (Leu)

c)CUU: UUU (Phe), CCU (Pro), CUC (Leu)
CUC: UUC (Phe), CCC (Pro), CUG (Leu)
CUA: UUA (Leu), CCA (Pro), CUU (Leu)
CUG: UUG (Leu), CCG (Pro), CUA (Leu)
UUG: CUG (Leu), UCG (Ser), UUA (Ser)
UUA: CUA (Leu), UCA (Ser), UUG (Leu)

d)UUA: AUA (Met), UAA (Halt), UUU (Phe), GUA (Val), UGA
(Halt), UUC (Phe)

UUG: AUG (Met), UAG (Stop), UUU (Phe), GUG (Val), UGG (Trp), UUC (Phe)

CUU: GUU (Val), CGU (Arg), CUG (Leu), AUU (Ile)
CUC: AUC (Ile), CAC (His), CUA (Leu), GUC (Val), CGC (Arg), CUG (Leu)

CUA: AUA (Ile), CAA (Gln), CUC (Leu), GUA (Val), CGA (Arg), CUG (Leu)

Sequenz der DNA-Matrize: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Nukleotidzahl: 24 Nukleotide (1 @ T 3' und 24 an T 5')

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGC AAU CAA CUA UAU UGA-3'

Aminosäuresequenz: Amino-Met Thr Gly Asn Gln Leu Tyr Stop-Carboxyl

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG CCG TCA GTT GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGC AGU CAA CUA UAU UGA-3'

Aminosäuren: Amino-Met Thr Gly Ser Gln Leu Tyr-Carboxyl

b)Der Übergang führt zur Bildung eines UAA-Nonsense-Codons.

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG CCG TTA ATT GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGC AAU UAA CUA UAU UGA-3'

Aminosäuresequenz: Amino-Met Thr Gly Asn-Carboxyl

c) Die Deletion um ein Nukleotid führt zu einer Frameshift-Mutation.

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG CGT TAG TTG ATA TAA CT-5'
mRNA-Sequenz: 5'-AUG ACC GCA GUC AAC UAU AUU GA-3'

Aminosäuren: Amino-Met Thr Ala Ile Asn Tyr Ile -Carboxyl

d) Die Transversion führt zur Substitution von Gln durch His im Protein.

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG CCG TTA GTA GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGC AAU CAU CUA UAU UGA-3'
Aminosäuren: Amino-Met Thr Gly Asn His Leu Tyr-Carboxyl

Mutierte Sequenz: 3'-TAC TGG CCG TTA GTG GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGC AAU CAC CUA UAU UGA-3'
Aminosäuren: Amino-Met Thr Gly Asn His Leu Tyr-Carboxyl

e) Die Addition der drei Nukleotide führt zur Addition von Thr an das Amino
Säuresequenz des Proteins und ist eine In-Frame-Insertion.

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG TGG CCG TTA GTT GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC ACC GGC AAU CAA CUA UAU UGA-3'

Aminosäuren: Amino-Met Thr Thr Gly Asn Gln Leu Tyr-Carboxyl

f) Das Protein behält die ursprüngliche Aminosäuresequenz bei.

Originalsequenz: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5'
Mutierte Sequenz: 3'-TAC TGG CCA TTA GTT GAT ATA ACT-5'
mRNA-Sequenz: 5'-AUG ACC GGU AAU CAA CUA UAU UGA -3'


Zugangsoptionen

Erhalten Sie vollen Zugriff auf Zeitschriften für 1 Jahr

Alle Preise sind Nettopreise.
Die Mehrwertsteuer wird später an der Kasse hinzugefügt.
Die Steuerberechnung wird während des Bezahlvorgangs abgeschlossen.

Erhalten Sie zeitlich begrenzten oder vollständigen Artikelzugriff auf ReadCube.

Alle Preise sind Nettopreise.


BIOL 3500: DNA-Mutationen

Eine richtige Form des aktiven Zentrums wird durch 2 Aminosäuren mit entgegengesetzten Ladungen erzeugt, die sich anziehen (Glu mit einer - Ladung und Arg mit einer + Ladung) eine Mutation von Arg zu einer ungeladenen Aminosäure führt zu einer falschen Form des aktiven Zentrums Die Mutation einer nahegelegenen Aminosäure von ungeladen zu + geladen (Lys) führt zu einer nahezu korrekten Form des aktiven Zentrums, so dass es auch mit 2 Mutationen funktionieren kann
(Zwei Fehler können manchmal richtig sein?)

Ames-Test: verwendet Bakterientester-Stämme, um nach chemischen Mutagenen zu suchen

Ex. Salmonella-Zellen, die Histidin-Auxotrophe sind
(sind empfindlich gegenüber Mutation durch Chemikalien)
- Zellen mutagenes Mutagen hinzufügen
- Bei Mutagen: Revertante Mutation erzeugt His prototrophe Kolonien
- Wenn nicht mutagen: kein Wachstum (kann nicht zu WT zurückkehren)
*Tests, um festzustellen, ob eine Chemikalie ein Mutagen ist, indem getestet wird, ob sie bei Zugabe zu Histidin-Auxotrophen zu Prototrophen mutiert werden (vorher konnte es ohne Histidin nicht überleben, dann nach der Mutation)

Auxotrophe: benötigen Chemikalien, die im Wachstumsmedium nicht synthetisiert werden können

Viele Chemikalien sind selbst nicht mutagen, werden aber durch enzymatische Entgiftungswege in der Leber in Mutagene umgewandelt

1. Leberenzym (S9-Extrakt) hinzufügen
2. Testchemikalie in die Mitte der Platte geben – Medium ohne Histidin
3. Negativkontrolle:
Platte mit nicht mutagenem Lösungsmittel - wenige Kolonien haben spontane Mutationen
4. Anzahl der revertanten Kolonien Maß für die Mutagenstärke (die Prüfchemikalie wird nur auf die Mitte der Platte ohne Histidin aufgetragen – ein positives Ergebnis ist, wenn eine große Menge revertanter Zellen, auch bekannt als solche, die aufgrund einer Mutation überleben konnten, die Mitte, wo die Prüfchemikalie hinzugefügt wurde, wenn eine kleine Menge und nicht umgebende Mitte, ihr negatives Ergebnis und die überlebenden von spontanen Mutationen stammten, nicht die Chemikalie, die als Mutagen wirkt)

Normale Personen:
- Bestimmte Gene und Chromosomenpositionen enthalten Regionen mit Trinukleotid-Wiederholungen
- Sequenzen werden ohne Mutation von den Eltern auf die Nachkommen übertragen
*Normale Menschen haben diese, aber es ist wichtig, wie viele

Wenn die Anzahl der Trinukleotid-Wiederholungssequenzen zunimmt, kann dies zu Mutationen führen

TNRE-Störungen resultieren, wenn die Wiederholungskopienzahl über die kritische Größe ansteigt (Wiederholungsort erweitert sich häufig)
*Für jede Trinukleotidsequenz gibt es einen Normalbereich und einen (kritischen) Krankheitsbereich

2. Der Schweregrad hängt von der Vererbung von Mutter oder Vater ab (wie wahrscheinlich ist es, dass er sich in zukünftigen Generationen auf mehr Wiederholungen ausdehnt)
Ex.
- HD: TNRE wahrscheinlich, wenn die Erbschaft vom Vater stammt
- Myotone Muskeldystrophie verschlechtert sich eher, wenn sie von der Mutter stammt

3. Ursache nicht gut verstanden

4. Erhöhte Wiederholungen verändern die DNA-Struktur (Stammschleifenbildung)

Häufige Ursachen / Beschreibung

1. Abberante Rekombination – Abnormales Crossing-Over kann zu Deletionen, Duplikationen, Translokationen und Inversionen führen

2. Abberante Segregation – Eine abnormale Chromosomensegregation kann Aneuploidie oder Polyploidie verursachen

3. DNA-Replikationsfehler – Fehler durch DNA-Polymerase können Punktmutationen verursachen

4. Toxische Stoffwechselprodukte – Produkte normaler Stoffwechselprozesse können chemisch reaktive Stoffe sein, die
kann die DNA-Struktur verändern


Abstrakt

In den letzten Jahren ist das Interesse an der Epigenetik von Krebs explodiert. Dies war eine Folge sowohl der aufregenden Koaleszenz der Chromatin- und DNA-Methylierungsfelder als auch der Erkenntnis, dass DNA-Methylierungsänderungen an menschlichen Malignomen beteiligt sind. Die Allgegenwart von DNA-Methylierungsänderungen hat den Weg für eine Vielzahl innovativer diagnostischer und therapeutischer Strategien geebnet. Jüngste Fortschritte belegen das große Versprechen von DNA-Methylierungsmarkern als leistungsstarke zukünftige Werkzeuge in der Klinik.


Proteine, die an eine bestimmte DNA-Sequenz binden, um die Transkription der genetischen Information von DNA zu RNA zu kontrollieren.

DNA-Methylierung, die Bakterien vor Restriktionsendonuklease-Enzymen schützt und einen Abwehrmechanismus gegen das Eindringen von Bakteriophagen und Viren bietet.

DNA-Regionen, die sich in der Nähe von Transkriptionsstartstellen befinden und die Transkriptionsinitiation kontrollieren.

Genetische Elemente, die in RNA transkribiert, dann revers zurück in DNA transkribiert und in das Genom eingefügt werden.

Eine epigenetische Markierung einer Kopie des Gens (von der Mutter oder vom Vater), die die Genexpression auf elternspezifische Weise sicherstellt.

Gen-Silencing von Transposons durch epigenetische Mechanismen, einschließlich DNA-Methylierung und die Wirkung kleiner nicht-kodierender RNAs, die die Transkription verhindert und die Genomstabilität gewährleistet.

Posttranslationale chemische Modifikationen von Aminosäureresten an einem Histon.

Proteine, die den Zugang zur genetischen Information kontrollieren, indem sie entweder Histonmodifikationen induzieren oder Energie verwenden, um Histon-DNA-Wechselwirkungen zu verändern.

(CGI). Regionen mit hoher Cytosin-Phosphat-Guanin (CpG)-Dinukleotiddichte.

Zellen, die sich in jedes andere Gewebe des Körpers differenzieren können.

Regulatorische Regionen des Genoms, die durch Histonmodifikationen markiert sind und die Transkription ihrer assoziierten Gene verstärken, wenn sie an Transkriptionsfaktoren gebunden sind.

(BER). Ein zellulärer Mechanismus, der kleine Basenläsionen, die durch fehlgepaarte oder modifizierte DNA-Basen verursacht werden, aus der DNA entfernt.

Ein Acht-Protein-Komplex aus zwei Histon-H2A-H2B-Dimeren und zwei Histon-H3-H4-Dimeren, die zusammen den Kern des Nukleosoms bilden.

Eine Art von weißen Blutkörperchen, die für das adaptive Immunsystem von grundlegender Bedeutung ist.

Ein Prozess, bei dem B-Zellen Teile des Locus der schweren Immunglobulinkette neu anordnen, um Antikörper mit unterschiedlichen Eigenschaften zu erzeugen.

Repetitive Nukleotidsequenzen, die die Enden der Chromosomen schützen.

Sequenzen, die im gesamten Genom mehrfach vorkommen.

Ein Enzym, das die Transkription von DNA zu RNA katalysiert.

Ein Adapter-RNA- und Aminosäure-Träger, der bei der Dekodierung von mRNA für die Translation in die Proteinsynthese hilft.

Enzyme, die DNA an endogenen Phosphodiesterbindungen schneiden.

DNA-Spaltung an der Phosphodiesterbindung führt zur Eliminierung des 3'-Phosphatrestes.

DNA-Spaltung an der Phosphodiesterbindung führt zur Eliminierung des 5'-Phosphatrestes.

Clustered Regular Interspaced Short Palindromic Repeats (CRISPR)-Systeme

Genom-Editing-Systeme wie CRISPR-Cas9, die auf einem bakteriellen Virus-Abwehrmechanismus beruhen, der repetitive DNA-Sequenzen umfasst, die Schnipsel viraler DNA enthalten. Durch Manipulation von CRISPR-Systemen kann DNA an einer gewünschten Stelle geschnitten werden, wodurch Gene entfernt oder hinzugefügt werden können.

Transkriptionsaktivator-ähnliche Effektoren

(Erzählungen). Proteine, die so programmiert werden können, dass sie auf bestimmte DNA-Sequenzen im Genom abzielen.


Weitere Informationen

Zugangscodes: Die folgenden Koordinaten sind in der RCSB Protein Data Bank hinterlegt. GRE-GRDBD ist der GRDBD- und GRE-Komplex (PDB-ID: 5EMQ), smGRE-GRDBD ist der GRDBD- und smGRE-Komplex (PDB-ID: 5EMC), mmGRE-GRDBD ist der GRDBD- und mmGRE-Komplex (PDB-ID: 5EMP). BisChIP-seq-Daten können vom National Center for Biotechnology Information GEO (GSE64171) heruntergeladen werden.

So zitieren Sie diesen Artikel: Jin, J. et al. Die Auswirkungen der Cytosin-Methylierung auf allgemeine Transkriptionsfaktoren. Wissenschaft Repräsentant 6, 29119 doi: 10.1038/srep29119 (2016).


Zusätzliche Informationen

S1 Tabelle. Konzentration der DNA-Proben vor der Bisulfit-Behandlung.

Die Konzentration der unbehandelten DNA-Proben, die von PBMCs von fünf Spendern vor der Bisulfit-Behandlung erhalten wurden, gemessen mit dem Qubit dsDNA BR (broad range) Assay Kit.

S2-Tabelle. Menge der zugeführten DNA für die Bisulfit-Behandlung und Konzentration der DNA-Proben nach der Bisulfit-Behandlung.

Zwei Aliquots aller fünf DNA-Proben wurden zweimal unabhängig behandelt, was zehn Bisulfit-behandelte Proben ergab, und anschließend wurden die doppelten Proben gepoolt. Die Quantifizierungsmessungen werden zweifach mit dem Qubit ssDNA Assay-Kit durchgeführt, und die angezeigten Daten sind Durchschnittswerte ± SD dieser zehn Konzentrationen.

S3-Tabelle. Cq-Werte und Rangfolge der qPCR-Experimente aus den sechs verwendeten Primerpaaren.

Zunächst wurde der Durchschnitt der drei technischen Replikate für alle fünf Proben berechnet. Die angegebenen Daten sind das geometrische Mittel der Mittelwerte aus den fünf Spenderproben. Genomische DNA ist die Messung von unbehandelter DNA, die nur für die Cytosin-freien Primer durchgeführt wird, da sie vor und nach der Behandlung die gleiche Effizienz aufweisen. Die verschiedenen Kits sind nach den Cq-Werten für jedes Primerpaar geordnet (Rang in der Tabelle). Anschließend wird der Median dieser Platzierungen berechnet, um eine endgültige Platzierung zu ermitteln. Dies ist die in Tabelle 1 angegebene Rangfolge.

S4 Tabelle. Ergebnisse und Rangfolge der dPCR-Experimente aus den drei verwendeten Primerpaaren.

Zunächst wurde der Durchschnitt der beiden technischen Replikate berechnet und für alle fünf Proben auf den DNA-Input normalisiert. Die angegebenen Daten sind das geometrische Mittel der Durchschnittswerte aller fünf Spenderproben. Die verschiedenen Kits sind nach der Anzahl der Kopien pro ng mit Bisulfit behandelter DNA für jedes Primerpaar geordnet (Rang in der Tabelle). Anschließend wird der Median dieser Platzierungen berechnet, um eine endgültige Platzierung zu ermitteln. Dies ist die endgültige Rangfolge in Tabelle 1.

S5-Tabelle. Die Prozentsätze des gesamten DNA-Verlustes in den Proben.

Der DNA-Verlust wird durch dPCR vor und nach der Bisulfit-Behandlung bewertet. Diese dPCR misst die intakten Kopien bestimmter Längen, die in den Proben vorhanden sind. Um die in der Tabelle angegebenen Mittelwerte zu erhalten, wurde der Mittelwert der beiden technischen Replikate sowohl vor als auch nach der Bisulfit-Behandlung berechnet. Diese Durchschnittswerte wurden verwendet, um den durchschnittlichen Verlust pro Kit aller fünf Spenderproben zu berechnen. Anschließend wurden die geometrischen Mittelwerte und die Standardabweichungen dieser Mittelwerte berechnet.

S6-Tabelle. Umwandlungseffizienzen und Gesamtmethylierungsprozentsatz für die verschiedenen Kits.

Die Daten werden durch Sequenzierung der 8 Kits gewonnen, die in den vorherigen Fragmentierungsbewertungen am besten abgeschnitten haben. Eine von fünf Spenderproben wurde verwendet und zwei separate PCR-Produkte wurden sequenziert: die Amplikons CFP2 und CCP3. CFP2 (414 bp) zählt 62 Cs, davon 2 CpGs CCP3 (476 bp) zählt 159 Cs, davon 32 CpGs.

S7-Tabelle. Umrechnungsprotokoll für verschiedene Temperaturen für Epitect (Kit 10).

Die verschiedenen Protokolle folgten einem festen Zeitplan, wie im Handbuch des Herstellers angegeben. Das Temperaturprotokoll 3 entspricht dem vom Hersteller bereitgestellten Protokoll.

S8-Tabelle. Konvertierungsprotokoll für verschiedene Zeitpläne für Epitect (Kit 10).

Die verschiedenen Protokolle folgten immer dem Temperaturschema, wie es im Handbuch des Herstellers angegeben ist. Zeitprotokoll 3 entspricht dem vom Hersteller bereitgestellten Protokoll.

S9-Tabelle. Konzentration nach Elution mit Epitect (Kit 10) mit den unterschiedlichen Zeit- und Temperaturprotokollen, wie in den Tabellen S7 und S8 dargestellt.

Am Ende des Protokolls wurden 2 Elutionen derselben Probe durchgeführt (wie vom Hersteller empfohlen, um die DNA-Ausbeute zu maximieren). Die angegebenen Daten sind eine einzelne Messung des Donors, der in diesen Zeit- und Temperaturexperimenten verwendet wurde.

S10-Tabelle. Primersequenzen und Annealing-Temperaturen für qPCR und dPCR.

S1 Abb.

Bioanalyzer (obere Plots) und Gelelektrophorese (untere Plots) Analyse der verschiedenen Kits. Die in dieser Ergänzung gezeigten Diagramme zeigen die Elektrophoresedaten der fünf Spenderproben.

S2 Abb. Vergleich verschiedener Recovery-Analysen (rot: Qubit vs. schwarz: dPCR).

Diese Wiederfindung basiert auf der Menge des gesamten DNA-Verlustes in den Proben, wie in Tabelle S5 gezeigt.

S3 Abb. qPCR-Analyse der alternativen Protokolle aus dem Epitect Bisulfit-Kit wie in den Tabellen S7 und S8 gezeigt.

Oberes Feld: Protokoll in Umwandlungstemperatur geändert (S7-Tabelle). Unteres Feld: Protokoll in Umwandlungszeit geändert (S8-Tabelle). Die Ergebnisse sind als Cq-Werte ± SD angegeben.

S4 Abb. dPCR-Analyse der alternativen Protokolle aus dem Epitect Bisulfit-Kit, wie in den Tabellen S7 und S8 gezeigt.

Oberes Feld: Protokoll in Umwandlungstemperatur geändert (S7-Tabelle). Unteres Feld: Protokoll in Umwandlungszeit geändert (S8-Tabelle). Die Ergebnisse sind als Anzahl intakter Kopien pro ng mit Bisulfit behandelter DNA, gemessen durch dPCR ± SD, angegeben.

S5 Abb.

Beispiel für die Schmelzkurven (obere Tafel) und die Caliper LabChip GX-Ergebnisse (untere Tafel) nach qPCR mit aspezifischen Schmelzkurven, aber speziellen Banden für dieselbe Reaktion: CCP1_after.

S6 Abb.

Beispiel für die Schmelzkurven (obere Tafel) und die Caliper LabChip GX-Ergebnisse (untere Tafel) nach qPCR mit aspezifischen Schmelzkurven, aber speziellen Banden für dieselbe Reaktion: CCP2_after.

S1-Datensatz. Sequenzierungsdaten, die für die Umwandlungseffizienz verwendet werden.

Fastq-Dateien der Sequenzierungsdaten, die für die Berechnung der Umwandlungseffizienz verwendet wurden.


Diskussion

Die DNA-Methylierung spielt eine zentrale Rolle bei der Entwicklung und Differenzierung von Zelllinien bei Pflanzen und Tieren [1, 3–6]. Während unser Wissen über DNA-Methylierungswege in Tieren, Pflanzen und Pilzen relativ weit fortgeschritten ist, ist über die DNA-Methylierung in mikrobiellen Eukaryoten, wie z. B. Ciliaten, nur sehr wenig bekannt. Obwohl frühe Arbeiten einheitlich die Cytosin-Methylierung in Paramecium aurelia, T. thermophila, oder O. trifallax [73–75] haben wir hier sowohl Methylcytosin als auch Hydroxymethyl-Cytosin als wichtige Akteure im Prozess der Genomumlagerung von . identifiziert O. trifallax. Wir haben diese Modifikationen mit hochempfindlicher Nano-Flow-UPLC-MS eindeutig identifiziert und ihre Funktionalität getestet, indem wir ihre Bildung mit Methyltransferase-Inhibitoren verhindert haben. Da frühere Arbeiten vegetative Proben von O. trifallax, von denen wir bestätigen, dass sie sowohl in Methylcytosin als auch in Hydroxymethylcytosin fehlen, wurde dies nicht nachgewiesen de novo Methylierung und Hydroxymethylierung, die wir zeigen, tritt nur vorübergehend während Genomumlagerungen auf. Um diese Beobachtungen zu untermauern, beschrieb ein Bericht aus dem Jahr 2003 de novo Methylierung im stichotrichösen Ciliat (und schließen O. trifallax relativ) Stylonychia lemnae [76]. In dieser Arbeit war die Cytosin-Methylierung, obwohl sie in niedrigen Konzentrationen in der vegetativen MHK nachgewiesen wurde, hauptsächlich während der Genomumlagerungsprozesse nachweisbar, wo sie eingeführt wurde de novo innerhalb eliminierter Transposon-ähnlicher Sequenzen [76]. Wie im O. trifallax -System wurde Methylierung in allen Sequenzkontexten innerhalb des transposablen Elements beobachtet und war in einer Region von etwa 500 bp geclustert [76]. Während unsere Ergebnisse im Allgemeinen die Schlussfolgerungen der S. lemnae Studie unterscheidet sich unsere Arbeit in einigen wichtigen Punkten: Da die Hydroxymethylierung noch nicht als wichtige epigenetische Markierung in der DNA identifiziert wurde, wurde sie nicht in S. lemnae zweitens, O. trifallax DNA-Methylierung/Hydroxymethylierung tritt auf einem viel höheren Niveau (70 % – 90 %) auf als in . berichtet S. lemnae (25%) drittens, O. trifallax weist eine signifikante Modifikation mindestens einiger makronukleärer Chromosomen und abweichende Spleißprodukte auf, von denen keines für . berichtet wurde S. lemnae viertens implizieren die hier präsentierten Daten direkt die Methylierung/Hydroxymethylierung in O. trifallax's DNA-Eliminationsweg und fünftens berichten wir über ein 20 bp-Motiv, das eine Rolle bei der Steuerung der Methylierung/Hydroxymethylierung zu bestimmten Regionen spezifischer Chromosomen zu spielen scheint. Wir zeigen, dass der DNA-Methylierungsprozess eine bedeutende funktionelle Rolle bei der Eliminierung repetitiver Sequenzen in der MIC spielt, einschließlich einer sehr häufig vorkommenden Transposon-Familie und einer reichlich vorhandenen Satelliten-Wiederholungsfamilie. Wir berichten auch über die spezifische Methylierung/Hydroxymethylierung einer kleinen Anzahl von aberrant umgeordneten Molekülen, aber nicht ihrer korrekt umgeordneten Gegenstücke, was auf eine Rolle der DNA-Modifikation bei der Fehlererkennung während der Chromosomenumlagerung und/oder beim Abbau solcher falsch umgelagerten Moleküle hindeutet.

Die hier präsentierten funktionellen Daten stützen eine Rolle für die DNA-Methylierung in Abbauwegen, da die Methylierung in der DNA des elterlichen MAC angereichert erscheint, der zur Eliminierung abzielt, sowie in repetitiven MIC-eliminierten Sequenzen. Wir fanden, dass die Hemmung von DNA-Methyltransferasen durch Decitabin zu einer signifikanten Demethylierung von 6 von 9 MAC-Chromosomen und einem MIC-Locus (der 170 bp Satellitenwiederholung Abbildung 7c) führte. Gleichzeitig mit dem Decitabin-induzierten Methylierungsverlust dieser Chromosomen beobachteten wir eine leichte, aber oft statistisch signifikante Akkumulation der Chromosomen selbst (das native DNA-Signal in Abbildung 7c). Obwohl diese Akkumulation mit einem maximalen 1,5- bis 2-fachen Anstieg bescheiden ist, liefern diese Daten über mehrere Chromosomen hinweg überzeugende Unterstützung für eine enge Verbindung zwischen DNA-Methylierung/Hydroxymethylierung und Abbau während der Genomumlagerung.

Weitere Unterstützung für das Modell liefert die Untersuchung von Zellen, die nach Azacitidin- und Decitabin-Behandlung eine vollständige Genomumlagerung abgeschlossen haben: 170 bp-Satellitenwiederholungen und TBE1-Transposons zeigen eine statistisch signifikante Akkumulation im Vergleich zu unbehandelten Kontrollen (Abbildung 8b,c,d). Darüber hinaus induziert die Behandlung mit Azacitidin eine Ansammlung von Keimbahn TEBPα und eine Abnahme der MAC-Versionen desselben Gens (Abbildung 8b, c). Wir beobachten andere Defekte der Genomumlagerung nach Azacidin- oder Decitabin-Behandlung: zusammen mit TEBPα, Contig4414 zeigt ebenfalls niedrigere Spiegel, während zwei andere Chromosomen erhöhte Spiegel zeigten (Contig18539 und Contig15988), was mit der Retention der elterlichen MAC-Chromosomen übereinstimmt, die nicht richtig abgebaut wurden. Diese Daten zeigen die Komplexität der funktionellen Konsequenzen der Hemmung der DNA-Methylierung: Die Auswirkungen können direkt (wie z die MIC-Version eines Gens und produziert daher nicht genügend MAC-Produkt). Es sind weitere Arbeiten erforderlich, um diese Effekte zu entwirren, aber zusammengenommen implizieren die Daten einen DNA-Methylierungs-/Hydroxymethylierungsweg bei der Eliminierung von repetitiven und Einzelkopie-Elementen aus dem MIC-Genom und bei der Produktion eines funktionellen makronuklearen Genoms.

Die Beziehung zwischen Cytosin-Methylierung und Hydroxymethylierung in O. trifallax bietet neue Herausforderungen. Bei Mäusen wird beispielsweise die Spermien-DNA methyliert, aber die väterliche Genommethylierung geht bei der Befruchtung schnell verloren [77], da der Embryo eine epigenetische Umprogrammierung und Etablierung neuer Methylierungsmuster durchläuft [78, 79]. Hydroxymethylcytosin erscheint im väterlichen, aber nicht im mütterlichen Vorkern während dieser dramatischen Umschreibung des epigenetischen Codes [80, 81], die mit dem Verlust der väterlichen Methylierung zusammenfällt. Andere Arbeiten haben Hydroxymethylierung mit gewebespezifischer Promotoraktivierung und vermutlich Demethylierung während der Entwicklung in Verbindung gebracht [82]. Die Hydroxymethylierung hängt von einer bereits bestehenden Methylierung ab und steht damit in einem dynamischen Spannungsverhältnis: Beide Modifikationen können die gleichen Genomregionen markieren [83], wie wir in O. trifallax, und dieses Phänomen ist besonders bei embryonalen Stammzellen verbreitet [84, 85]. Die Hydroxymethylierung antagonisiert jedoch auch die Methylierung, indem sie ihre Entfernung steuert und/oder Methylcytosin-bindende Heterochromatinproteine ​​blockiert [86, 87]. Der Zusammenhang zwischen Methylierung und Abbau in O. trifallax legt nahe, dass der Organismus die Hydroxymethylierung als ausgleichende, stabilisierende Kraft einsetzen könnte, um möglicherweise auf Gene abzuzielen, die für die Konjugation wichtig sind. An dieser Assoziation können auch andere Mechanismen beteiligt sein: O. trifallaxDas am meisten hydroxymethylierte ribosomale Proteingen ist ein Homolog von L12, das in Bakterien und Hefen die Ribosomen-Initiation und -Elongation regulieren kann [88, 89]. Daher können Veränderungen in der Expression des L12-kodierenden Chromosoms Auswirkungen auf das Proteom haben und möglicherweise sogar die Translation stoppen, während der Organismus die aufwendigen Schritte der Genomumgestaltung durchläuft.


Anmerkung des Herausgebers: Springer Nature bleibt in Bezug auf gerichtliche Ansprüche in veröffentlichten Karten und institutionellen Zugehörigkeiten neutral.

Ergänzende Abbildung 1 Screening von Boran-haltigen Verbindungen und vorgeschlagener Mechanismus für die Boranreaktion von 5caC.

(ein) Boranhaltige Verbindungen, die auf die Umwandlung von 5caC zu DHU in einem 11mer-Oligo untersucht wurden, wobei die Umwandlungsrate durch MALDI geschätzt wurde. 2-Picolinboran (Pic-Boran), Boranpyridin, tert-Butylaminboran und Ammoniakboran konnten 5caC vollständig in DHU umwandeln, während Ethylendiaminboran und Dimethylaminboran nur eine Umwandlungsrate von etwa 30 % ergaben. Mit Morpholinboran, 4-Methylmorpholinboran, Trimethylaminboran und Cyclohexylaminboran wurden keine nachweisbaren Produkte gemessen (n.d.). Andere Reduktionsmittel wie Natriumborhydrid und Natriumtri(acetoxy)borhydrid zersetzten sich in sauren Medien schnell und führten zu einer unvollständigen Umsetzung. Natriumcyanoborhydrid wurde aufgrund des Potenzials zur Bildung von Blausäure unter sauren Bedingungen nicht verwendet. Pic-Boran und Pyridinboran wurden wegen des vollständigen Umsatzes, der geringen Toxizität und der hohen Stabilität ausgewählt. (B) Vorgeschlagener Mechanismus für die Boranreaktion von 5caC zu DHU.

Ergänzende Abbildung 2

Vorgeschlagener Mechanismus für die Boranreaktion von 5fC zu DHU.

Ergänzende Abbildung 3 MALDI-Charakterisierung von 5fC und 5caC enthaltenden Modell-DNA-Oligos, die mit Pic-Boran mit oder ohne Blockierung von 5fC und 5caC behandelt wurden.

5fC wurde durch O-Ethylhydroxylamin blockiert, das zu Oxim wird und der pic-Boran-Umwandlung widersteht, während 5caC durch Ethylamin über EDC-Konjugation blockiert und in Amid umgewandelt wurde, das die Umwandlung durch pic-Boran blockiert. Alle Experimente wurden einmal durchgeführt. Die berechnete MS wurde in Schwarz dargestellt und die beobachtete MS wurde in Rot dargestellt.

Ergänzende Abbildung 4 MALDI-Charakterisierung von 5mC und 5hmC enthaltenden Modell-DNA-Oligos, die mit KRuO . behandelt wurden4 und Pic-Boran mit oder ohne Blockierung von 5hmC.

5hmC konnte durch βGT mit Glucose blockiert und in 5gmC umgewandelt werden. 5mC, 5hmC und 5gmC konnten von Pic-Boran nicht umgewandelt werden. 5hmC could be oxidized by KRuO4 to 5fC, and then converted to DHU by pic-borane. All experiments were performed once. Calculated MS was shown in black, observed MS was shown in Red.

Supplementary Figure 5 Restriction enzyme digestion showed TAPS effectively converts 5mC to T.

(ein) Illustration of restriction enzyme digestion assay to confirm the sequence change caused by TAPS. (B) Taq α tests to confirm the C-to-T transition caused by TAPS. A PCR-amplified 222 bp model DNA with Taq α I restriction site in the middle can be cleaved, whereas the amplified product of 5mC-TAPS stayed intact, suggesting loss of the restriction site and hence C-to-T transition. TAPS did not result in C-to-T transition on the unmethylated cytosine since C-TAPS was cleaved in the same way as the original untreated C. Experiment was performed once.

Supplementary Figure 6 Complete C-to-T transition induced after TAPS, TAPSβ and CAPS as indicated by Sanger sequencing.

Model DNA containing single methylated and single hydroxymethylated CpG sites was prepared as described in Supplementary Note 3. TAPS conversion was done following the NgTET1 Oxidation und Pyridine borane reduction protocols described in the Methoden. TAPSβ conversion was done following the 5hmC blocking, NgTET1 Oxidation und Pyridine borane reduction Protokolle. CAPS conversion was done following the 5hmC oxidation und Pyridine borane reduction Protokolle. After conversion, 1 ng of converted DNA sample was PCR amplified by Taq DNA Polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC whereas CAPS selectively converted 5hmC. None of the three methods caused conversion on unmodified cytosine and other bases.

Supplementary Figure 7 TAPS is compatible with various DNA and RNA polymerases and induces complete C-to-T transition shown by Sanger sequencing.

The model DNA containing methylated CpG sites for the polymerase test and primer sequences is described in Supplementary Note 3. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil plus polymerase, Taq polymerase, and Vent exo- polymerase read DHU as T and therefore induce complete C-to-T transition after PCR. Alternatively, primer extension was done with a biotin-labelled primer and isothermal polymerases including Klenow fragment, Bst DNA polymerase, and phi29 DNA polymerase. The newly synthesized DNA strand was separated by Dynabeads® MyOne Streptavidin C1 and then amplified by PCR with Taq polymerase and processed for Sanger sequencing. T7 RNA polymerase could efficiently bypass DHU and insert adenine opposite the DHU site, which is shown by RT-PCR and Sanger sequencing. Other commercial polymerases including KAPA HiFi polymerase, NEB Q5 polymerase, and Phusion polymerase were also tested but failed to amplify DHU containing DNA efficiently.

Supplementary Figure 8 DHU does not show PCR bias compared to T and C.

A model DNA containing one DHU/U/T/C modification was synthesized with the corresponding DNA oligos as described in Supplementary Note 3. Standard curves for each model DNA with DHU/U/T/C modification were plotted based on qPCR reactions with 1:10 serial dilutions of the model DNA input (from 0.1 pg to 1 ng). Every qPCR experiment was run in triplicates (n=3 technical replicates). The slope of the regression between the log concentration (ng) values and the average Ct values was calculated by SLOPE function in Excel. PCR efficiency was calculated using the following equation: Efficiency % = (10^(-1/ Slope)-1)*100% Amplification factor was calculated using the following equation: Amplification factor=10^(-1/Slope). The PCR efficiency for the model DNAs with DHU or T or C modification were almost the same, which demonstrated that DHU could be read through as a regular base and would not cause PCR bias.

Supplementary Figure 9 TAPS completely converted 5mC to T regardless of DNA fragment length.

(ein) Agarose gel images of the TaqαI-digestion assay confirming complete 5mC to T conversion in all samples regardless of DNA fragment length. 194 bp model sequence from the lambda genome was PCR amplified after TAPS and digested with TaqαI enzyme. The PCR product amplified from unconverted sample could be cleaved, whereas products amplified on TAPS treated samples stayed intact, suggesting loss of restriction site and hence complete C-to-T transition. Experiment was performed once. (B) The C-to-T conversion percentage was estimated by gel band quantification as 100% for all DNA fragment lengths tested.

Supplementary Figure 10 The conversion and false positive rate for different TAPS conditions.

The combination of mTet1 and pyridine borane achieved the highest conversion rate of methylated C (96.5%, calculated with fully CpG methylated Lambda DNA) and the lowest conversion rate of unmodified C (0.23%, calculated with 2kb unmodified spike-in), compared to other conditions with NgTET1 or pic-borane. Shown above are the conversion rates +/- SE of all tested cytosine sites (N of 2kb unmodified positions = 1041, N of covered bacteriophage lambda CpG positions used: mTet1 pyridine borane 6226, mTet1 pic-borane 5871, NgTET1 pyridine borane 5768, NgTET1 pic-borane 6226).

Supplementary Figure 11 TAPS resulted in more even coverage and fewer uncovered positions than WGBS.

Comparison of coverage depth across (ein) all bases (N = 2 725 765 481) and (B) CpG sites (N = 43 445 914, based on mm9 genome, which includes potential genetic variants in E14 genome) between WGBS and TAPS, computed on both strands. For ‘TAPS (down-sampled)’, random reads out of all mapped TAPS reads were selected so that the median coverage matched the median coverage of WGBS. Positions with coverage above 50× are shown in the last bin.

Supplementary Figure 12 Modification levels around CpG Islands.

Average modification levels in CpG islands (binned into 20 windows) and 4 kb flanking regions (binned into 50 equally sized windows). Bins with coverage below 3 reads were ignored.

Supplementary Figure 13 TAPS exhibits smaller coverage-modification bias than WGBS.

All CpG sites were binned according to their coverage, and the mean (blue) and the median (orange) modification values are shown in each bin for WGBS (ein) and TAPS (B). The CpG sites covered by more than 100 reads are shown in the last bin. The lines represent a linear fit through the data points.

Supplementary Figure 14 Distribution of modification levels across all chromosomes.

Average modification levels in 100 kb windows along mouse chromosomes, weighted by the coverage of CpG, and smoothed using a Gaussian weighted moving average filter with window size 10.

Supplementary Figure 15 Low-input gDNA and cell-free DNA TAPS libraries prepared with dsDNA KAPA HyperPrep library preparation kit.

Sequencing libraries were successfully constructed with as little as 1 ng of (ein) mESC gDNA and (B) cell-free DNA with KAPA HyperPrep kit. Experiment was performed once. Note that cell-free DNA has a sharp length distribution around 160 bp (nucleosome size) due to plasma nuclease digestion. After library construction, it becomes

300bp, which is the sharp band in (B).