Information

Wofür genau werden Computer bei der DNA-Sequenzierung verwendet?

Wofür genau werden Computer bei der DNA-Sequenzierung verwendet?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe den Wikipedia-Artikel zur DNA-Sequenzierung gründlich gelesen und kann eine Sache nicht verstehen.

Es gibt einige Hardcore-Chemie, die an dem Prozess beteiligt ist, der die DNA irgendwie spaltet und dann ihre Teile isoliert.

Dennoch gilt die DNA-Sequenzierung als sehr rechenintensiver Prozess. Ich verstehe nicht, was dort genau berechnet wird - welche Daten in Computer eingehen und welche Computer speziell berechnen.

Was genau wird dort berechnet? Wo erhalte ich weitere Informationen dazu?


Computer werden in mehreren Schritten der Sequenzierung verwendet, von den Rohdaten bis zur fertigen Sequenz:

Bildverarbeitung

Moderne Sequenzer verwenden normalerweise die Fluoreszenzmarkierung von DNA-Fragmenten in Lösung. Die Fluoreszenz kodiert für die verschiedenen Nukleobasen (= „Base“)-Typen (allgemein als A, C, G und T bezeichnet). Um einen hohen Durchsatz zu erreichen, werden Millionen von Sequenzierungsreaktionen parallel in mikroskopischen Mengen auf einem Glaschip durchgeführt, und für jede Mikroreaktion muss die Markierung bei jedem Reaktionsschritt aufgezeichnet werden.

Das bedeutet: Der Sequenzer macht progressive digitale Aufnahmen des Chips, der das Sequenzierungsreagenz enthält. Diese Fotos haben unterschiedlich gefärbte Pixel, die unterschieden werden und einem bestimmten Farbwert zugewiesen werden müssen.

Wie man sieht, ist dieses (stark vergrößert; Bild ist < 100 µm groß!) Bildfragment unscharf und viele Punkte überlappen sich. Dies macht es schwierig zu bestimmen, welche Farbe welchem ​​Pixel zuzuordnen ist (obwohl neuere Versionen der Sequenziermaschine verbesserte Fokussiersysteme haben und das Bild folglich schärfer ist).

Basisruf

Ein solches Bild wird für jeden Schritt des Sequenzierungsprozesses registriert, was ein Bild für jede Base der Fragmente ergibt. Für ein Fragment der Länge 75 wären das 75 Bilder.

Nachdem Sie die Bilder analysiert haben, erhalten Sie Farbspektren für jedes Pixel in den Bildern. Die Spektren für jedes Pixel entsprechen einem Sequenzfragment (oft als „Read“ bezeichnet) und werden separat betrachtet. Für jedes Fragment erhalten Sie also ein solches Spektrum:

(Dieses Bild wird durch einen alternativen Sequenzierungsprozess namens Sanger-Sequenzierung erzeugt, aber das Prinzip ist das gleiche.)

Nun müssen Sie anhand des Signals entscheiden, welche Basis für jede Position zugewiesen werden soll („Base Calling“). Für die meisten Positionen ist dies ziemlich einfach, aber manchmal überlappt oder fällt das Signal erheblich ab. Dies muss bei der Entscheidung über die Anrufqualität der Basis berücksichtigt werden (d. h. welche Vertrauenswürdigkeit Sie Ihrer Entscheidung für eine bestimmte Basis zuordnen).

Wenn Sie dies für jeden Lesevorgang tun, erhalten Sie bis zu Milliarden von Lesevorgängen, von denen jeder ein kurzes Fragment der ursprünglichen DNA darstellt, die Sie sequenziert haben.

Die meisten bioinformatischen Analysen beginnen hier; das heißt, die Maschinen geben Dateien aus, die die kurze Sequenz enthalten Fragmente. Jetzt müssen wir a . machen Reihenfolge von ihnen.

Mapping und Assemblierung lesen

Der entscheidende Punkt, der es ermöglicht, die Originalsequenz aus diesen kleinen Fragmenten wiederzugewinnen, ist die Tatsache, dass diese Fragmente (ungleichmäßig) zufällig verteilt über das Genom, und sie sind überlappend.

Der nächste Schritt hängt davon ab, ob Sie ein ähnliches, bereits sequenziertes Genom zur Hand haben. Dies ist häufig der Fall. Zum Beispiel gibt es eine hochwertige „Referenzsequenz“ des menschlichen Genoms und da alle Genomsequenzen aller Menschen zu ~99,9% identisch sind (je nachdem, wie Sie zählen), können Sie einfach nachsehen, wo Ihre Reads mit der Referenz übereinstimmen .

Zuordnung lesen

Dies geschieht, um nach einzelnen Veränderungen zwischen dem Referenzgenom und Ihrem aktuell untersuchten Genom zu suchen, um beispielsweise Mutationen zu erkennen, die zu Krankheiten führen.

Sie müssen also nur Karte die liest zurück zu ihrer ursprünglichen Position im Referenzgenom (in Blau) und sucht nach Unterschieden (wie Basenpaarunterschiede, Insertionen, Deletionen, Inversionen…).

Zwei Punkte erschweren dies:

  1. Du hast Milliarden (!) von Reads, und das Referenzgenom ist oft mehrere Gigabyte groß. Selbst bei der schnellsten denkbaren Implementierung der String-Suche würde dies unerschwinglich lange dauern.

  2. Die Saiten stimmen nicht genau überein. Zunächst einmal gibt es natürlich Unterschiede zwischen den Genomen - sonst würden Sie die Daten gar nicht sequenzieren, Sie hätten sie schon! Die meisten dieser Unterschiede sind einzelne Basenpaarunterschiede - SNPs (= Single Nucleotide Polymorphisms) -, aber es gibt auch größere Variationen, die viel schwieriger zu handhaben sind (und sie werden in diesem Schritt oft ignoriert).

    Außerdem sind die Sequenziermaschinen nicht perfekt. Viele Dinge beeinflussen die Qualität, allen voran die Qualität der Probenvorbereitung und winzige Unterschiede in der Chemie. All dies führt zu Fehler im liest.

Zusammenfassend müssen Sie die Position von Milliarden kleiner Strings in einem größeren String finden, der mehrere Gigabyte groß ist. All diese Daten passen nicht einmal in den Arbeitsspeicher eines normalen Computers. Und Sie müssen Diskrepanzen zwischen den Reads und dem Genom berücksichtigen.

Leider ergibt dies immer noch nicht das vollständige Genom. Der Hauptgrund ist, dass einige Regionen des Genoms sehr repetitiv und schlecht konserviert sind, so dass es unmöglich ist, Reads eindeutig auf solche Regionen abzubilden.

Als Konsequenz erhalten Sie stattdessen eindeutige, zusammenhängende Blöcke („Contigs“) von zugeordneten Lesevorgängen. Jedes Contig ist ein Sequenzfragment, wie Reads, aber viel größer (und hoffentlich mit weniger Fehlern).

Montage

Manchmal möchten Sie einen neuen Organismus sequenzieren, damit Sie keine Referenzsequenz zum Zuordnen haben. Stattdessen müssen Sie a de novo montage. Eine Assembly kann auch verwendet werden, um Contigs aus einem zugeordneten Read zusammenzufügen (es werden jedoch andere Algorithmen verwendet).

Wieder verwenden wir die Eigenschaft der Lesevorgänge, dass sie sich überlappen. Wenn Sie zwei Fragmente finden, die so aussehen:

ACGTCGATCGCTAGCCGCATCAGCAAACAACACGCTACAGCCT ATCCCCAAACAACACGCTACAGCCTGGCGGGGCATAGCACTGG

Sie können ganz sicher sein, dass sie sich im Genom wie folgt überlappen:

ACGTCGATCGCTAGCCGCATCAGCAAACAACACGCTACAGCCT ATCCCCATTCAACACGCTA-AGCTTGGCGGGGCATACGCACTG

(Beachten Sie noch einmal, dass dies keine perfekte Übereinstimmung ist.)

Anstatt nach allen Lesevorgängen in einer Referenzsequenzierung zu suchen, suchen Sie jetzt nach direkten Entsprechungen zwischen den Lesevorgängen in Ihrer Sammlung von Milliarden von Lesevorgängen.

Wenn du die vergleichst Kartierung von einer Lektüre bis zur Suche nach der Nadel im Heuhaufen (eine oft verwendete Analogie), dann zusammenbauen reads ist vergleichbar damit, alle Strohhalme im Heuhaufen miteinander zu vergleichen und nach Ähnlichkeit zu ordnen.


Denken Sie so darüber nach. Angenommen, Sie besitzen hundert Kopien von "Der Herr der Ringe", einem Roman mit 500000 Wörtern. Leider haben Sie diese hundert Kopien in Form von mehreren Millionen winziger Papierschnipsel, von denen jeder etwa zehn aufeinanderfolgende Wörter aus dem Roman enthält. Deine Aufgabe ist es, diese mehreren Millionen Zettel zu nehmen und sie so zu sortieren, dass du den Roman von Anfang bis Ende lesen kannst. Angenommen, Sie finden das Fragment

erstach diese abscheuliche Kreatur, wenn er eine Chance hatte!“ „Mitleid?

Sie könnten dann die anderen mehreren Millionen Fragmente nach einem Fragment durchsuchen, das dies in irgendeiner Weise überlappt. Vielleicht findest du

Chance!“ „Schade? Es war Mitleid, das seine Hand hielt. Mitleid und Barmherzigkeit:

Die Chancen stehen sehr gut, dass diese Fragmente zusammenpassen

erstach diese abscheuliche Kreatur, wenn er eine Chance hatte!“ „Mitleid? Es war Mitleid, das seine Hand hielt. Mitleid und Barmherzigkeit:

Aber vielleicht nicht! Vielleicht (1) gibt es ein weiteres Fragment des Romans, dasChance!“ „Schade?das ist die richtige überlappung, oder oh, habe ich übrigens erwähnt (2) Einige dieser Papierfetzen enthalten Fehler, die Sie auch erkennen und beseitigen müssen.

Das ist eine extrem rechenintensive Aufgabe. DNA-Assembler haben das gleiche Problem: Millionen und Abermillionen winziger DNA-Schnipsel, die sich überlappen, die Fehler enthalten können und die sortiert werden müssen, indem ihre Überlappungen analysiert und nach und nach kurze Fragmente zu immer längeren Fragmenten aufgebaut werden.


In einem Genom gibt es normalerweise Milliarden von Basenpaaren. Es ist jedoch unmöglich, alle auf einmal zu lesen. Die DNA wird fragmentiert und die Sequenz der Fragmente bestimmt. Sequenzierungstechniken der nächsten Generation sind schneller und billiger, produzieren aber nur kurze Fragmente (z. B. 100 Basenpaare, dies hängt von der Technologie ab). Es ist extrem rechenintensiv, diese Fragmente wieder zusammenzusetzen.

Weitere Informationen: Primer für die Assemblierung der Genomsequenz; Einführung in Naturmethoden


Wie Sie in der Frage erwähnt haben, teilen aktuelle Sequenzierungsplattformen die genomische DNA in viele kleine Stücke auf, die die Maschine dann analysiert. Das Produkt eines Sequenzierungsexperiments sind Millionen oder sogar Milliarden von kurzen "Reads" --- Strings von A, C, G und T, die die Nukleotide eines einzelnen DNA-Fragments darstellen.

Die DNA-Reads in dieser Form sind nicht besonders nützlich. Die Idee war zunächst, die Sequenz des gesamten DNA-Moleküls zu bestimmen. Hier kommt Genom-Assembly-Software ins Spiel – um die ursprüngliche Sequenz der genomischen DNA zu bestimmen, indem die optimale Anordnung überlappender Reads gefunden wird, um die ursprüngliche DNA-Sequenz zu rekonstruieren.

Computer sind in zwei Phasen dieses Prozesses von entscheidender Bedeutung: Erstens muss die Plattform im Sequenzierungsexperiment selbst Fluoreszenzsignale aufzeichnen und interpretieren, um die Sequenz-Reads überhaupt zu erzeugen; und zweitens werden sehr leistungsfähige Computer benötigt, um die Reads wieder zu einer zusammenhängenden Sequenz zusammenzusetzen, um die ursprüngliche DNA-Sequenz wiederherzustellen.


Wie sequenzieren wir DNA?

DNA Wir gehen davon aus, dass Sie die Beschreibung der DNA-Struktur gelesen haben, einen früheren Link in diesem Thread. rechts? Sie haben hoffentlich auch den Link gelesen, der DNA-Denaturierung, Annealing und Replikation beschreibt, da die folgende Seite auf diesen Grundlagen aufbaut.

Plasmid Ein „Plasmid“ ist ein kleines, kreisförmiges Stück DNA, das häufig in Bakterien vorkommt. Dieses harmlose Molekül könnte den Bakterien helfen, in Gegenwart eines Antibiotikums zu überleben, beispielsweise aufgrund der Gene, die es trägt. Für Wissenschaftler sind Plasmide jedoch wichtig, weil (i) wir sie in großen Mengen isolieren können, (ii) wir sie schneiden und spleißen können, indem wir beliebige DNA hinzufügen, (iii) wir sie wieder in Bakterien einsetzen können, wo sie Wir replizieren zusammen mit der bakterieneigenen DNA und (iv) wir können sie wieder isolieren - wir erhalten Milliarden von Kopien der DNA, die wir in das Plasmid eingefügt haben! Plasmide sind im Allgemeinen auf Größen von 2,5–20 Kilobasen (kb) beschränkt.

BAC Der Begriff 'BAC' ist ein Akronym für 'Bacterial Artificial Chromosom' und wird im Prinzip wie ein Plasmid verwendet. Wir konstruieren BACs, die DNA von Menschen oder Mäusen oder wo auch immer tragen, und wir inserieren die BAC in ein Wirtsbakterium mit dem Plasmid, wenn wir dieses Bakterium züchten, replizieren wir auch die BAC. Riesige DNA-Stücke können mit BACs leicht repliziert werden - normalerweise in der Größenordnung von 100-400 Kilobasen (kb). Mit BACs haben Wissenschaftler kloniert (repliziert). Dies ist, wie Sie später sehen werden, für das Human Genome Project von entscheidender Bedeutung.

Vektor Der „Vektor“ ist im Allgemeinen der grundlegende Typ von DNA-Molekül, der verwendet wird, um Ihre DNA zu replizieren, wie ein Plasmid oder ein BAC.

Einfügung Der „Einsatz“ ist ein Stück DNA, das wir absichtlich in einen anderen (einen „Vektor“) eingefügt haben, damit wir es replizieren können. Normalerweise ist das 'Einfügen' daher der interessante Teil. Im Fall des Human Genome Project oder anderer Sequenzierungsprojekte ist das Insert der Teil, den wir sequenzieren wollen - der Teil, den wir nicht kennen. Normalerweise kennen wir die komplette DNA-Sequenz des Vektors.

Schrotflinten-Sequenzierung Shotgun-Sequenzierung ist eine Methode zur Bestimmung der Sequenz eines sehr großen DNA-Stücks. Die grundlegende DNA-Sequenzierungsreaktion kann nur die Sequenz von einigen hundert Nukleotiden erhalten. Bei größeren (wie BAC-DNA) fragmentieren wir normalerweise die DNA und inserieren die resultierenden Stücke in einen geeigneten Vektor (normalerweise ein Plasmid), um sie zu replizieren. Nachdem wir die Fragmente sequenziert haben, versuchen wir, daraus die Sequenz der ursprünglichen BAC-DNA abzuleiten.


Techniken in der Sequenzierung

Automatisierte DNA-Sequenzierung

Die automatisierte Sequenzierung wurde entwickelt, um eine wirklich große Menge an DNA zu sequenzieren. Dieses Verfahren verwendet das Prinzip der Sanger-Kettenabbruchmethode. Anstatt dATP in der ursprünglichen Sanger-Methode zu markieren, wird jedes der in der Reaktion verwendeten Didesoxynukleotide mit einem anderen Fluoreszenzmarker markiert.

Nachdem die Verlängerungsreaktionen und der Kettenabbruch abgeschlossen sind, wird die Mischung zur Erarbeitung der DNA-Sequenz in eine Vertiefung eines Polyacrylamid-Plattengels oder in ein Röhrchen eines Kapillargelsystems gegeben und eine Elektrophorese durchgeführt, um die Moleküle entsprechend zu trennen zu ihren Längen. Nach der Trennung werden die Moleküle an einem Fluoreszenzdetektor vorbeigeführt, der in der Lage ist, die an die Didesoxynukleotide gebundenen Markierungen zu unterscheiden (Abb. 11.3). Der Detektor bestimmt daher, ob jedes Molekül mit einem A, C, G oder T endet. Die Sequenz kann zur Untersuchung ausgedruckt oder zur späteren Analyse direkt in einen Speicher eingegeben werden. Der gesamte Didesoxynukleotid-Sequenzierungsprozess wurde automatisiert, um die Erfassungsrate von DNA-Sequenzdaten zu erhöhen. Dies ist essentiell für groß angelegte Sequenzierungsprojekte wie solche, die ganze prokaryontische oder eukaryontische Genome beinhalten.

Abb. 11.3 . Der Prozess der automatisierten Sequenzierung. Das Verfahren ist dem Kettenabbruch von Sanger sehr ähnlich. (A) Jedes der in der Reaktion verwendeten Didesoxynukleotide ist mit einem anderen Fluoreszenzmarker markiert. Die Kettenabbruchsequenzierung erfolgt in einem Röhrchen und dieses Röhrchen enthält vier fluoreszenzmarkierte Didesoxynukleotide. Die Zahlen vor jeder Nukleotidkette repräsentieren die Länge der entsprechenden Nukleotidkette in jeder Reaktion. (B) Nach den Verlängerungsreaktionen wird die Mischung in eine Vertiefung eines Polyacrylamid-Plattengels oder in ein Röhrchen eines Kapillargelsystems geladen, und es wird eine Elektrophorese durchgeführt, um die Moleküle entsprechend ihrer Länge zu trennen. Nach der Trennung werden die Moleküle an einem Fluoreszenzdetektor vorbeigeführt, der in der Lage ist, zwischen den an den Didesoxynukleotiden angebrachten Markierungen zu unterscheiden.


Prinzipien der Identifizierung der DNA-Sequenz: 3 Prinzipien

Dieser Artikel beleuchtet die drei Prinzipien der Identifizierung von DNA-Sequenzen. Die drei Prinzipien sind: (1) Nukleinsäurehybridisierung (2) DNA-Sonden und (3) DNA-Chip-Mikroarray von Gensonden.

Prinzip Nr. 1. Nukleinsäurehybridisierung:

Die Hybridisierung von Nukleinsäuren (insbesondere DNA) ist die Grundlage für eine zuverlässige DNA-Analyse. Die Hybridisierung basiert auf dem Prinzip, dass ein einzelsträngiges DNA-Molekül einen komplementären DNA-Strang inmitten einer Mischung anderer DNA-Stränge erkennt und spezifisch daran bindet. Dies ist vergleichbar mit einer bestimmten Schlüssel-Schloss-Beziehung. Das allgemeine Verfahren zur Nukleinsäurehybridisierung ist wie folgt (Abb. 14.1).

Die einzelsträngige Ziel-DNA ist an einen Membranträger gebunden. Nun wird die DNA-Sonde (einzelsträngig und mit einer Detektorsubstanz markiert) zugegeben. Unter geeigneten Bedingungen (Temperatur, Ionenstärke) paart sich die DNA-Sonde mit der komplementären Ziel-DNA.

Die ungebundene DNA-Sonde wird entfernt. Die Nukleotidsequenz in der Ziel-DNA kann aus der bekannten Sequenz der DNA-Sonde identifiziert werden. Es gibt zwei Arten von DNA-Hybridisierung – radioaktiv bzw. nicht-radioaktiv, wobei DNA-Sonden, die mit Isotopen und Nicht-Isotopen markiert sind, als Detektoren verwendet werden.

Prinzip # 2. DNA-Sonden:

Eine DNA-Sonde oder eine Gensonde ist ein synthetisches, einzelsträngiges DNA-Molekül, das eine Ziel-DNA (durch komplementäre Basenpaarung) in einem Gemisch von Biomolekülen erkennen und spezifisch daran binden kann. DNA-Sonden sind entweder lang (> 100 Nukleotide) oder kurz (< 50 Nukleotide) und können an die gesamte oder einen kleinen Teil der Ziel-DNA binden. Die Größe der verwendeten DNA-Sonden variiert stark (kann von 10 Basen bis 10.000 Basen reichen). Die wichtigste Voraussetzung ist ihre spezifische und stabile Bindung mit Ziel-DNAs.

Methoden zur Gewinnung von DNA-Sonden:

Ein Großteil der DNA-Sonden wird im Labor chemisch synthetisiert. Es gibt jedoch viele andere Möglichkeiten, sie zu erhalten – Isolierung ausgewählter Genregionen, Klonierung intakter Gene, Herstellung von mRNAs.

Isolierung ausgewählter Genregionen:

Die DNA eines Organismus (zB eines Pathogens) kann unter Verwendung von Restriktionsendonukleasen geschnitten werden. Diese DNA-Fragmente werden in Vektoren kloniert und die DNA-Sonden können durch Screening selektiert werden.

Synthese von DNA-Sonden aus mRNA:

Die für eine bestimmte DNA-Sequenz (die ein Protein kodieren) spezifischen mRNA-Moleküle werden isoliert. Durch die Verwendung des Enzyms Reverse Transkriptase werden komplementäre DNA (cDNA) Moleküle synthetisiert. Diese cDNA kann als Sonde zum Nachweis der Ziel-DNA verwendet werden.

Wirkmechanismus von DNA-Sonden:

Das Grundprinzip von DNA-Sonden beruht auf der Denaturierung und Renaturierung (Hybridisierung) von DNA. Wenn ein doppelsträngiges DNA-Molekül physikalischer (Temperatur > 95°C oder pH < 10,5) oder chemischer (Zugabe von Harnstoff oder Formaldehyd) Veränderungen ausgesetzt wird, brechen die Wasserstoffbrückenbindungen und die komplementären Stränge werden getrennt.

Dieser Vorgang wird Denaturierung genannt. Unter geeigneten Bedingungen (d. h. Temperatur, pH, Salzkonzentration) können sich die beiden getrennten DNA-Einzelstränge wieder zusammensetzen, um die ursprüngliche doppelsträngige DNA zu bilden, und dieses Phänomen wird als Renaturierung oder Hybridisierung bezeichnet.

Radioaktives Detektionssystem:

Die DNA-Sonde ist normalerweise mit einem radioaktiven Isotop (üblicherweise Phosphor-32) markiert. Die Ziel-DNA wird gereinigt und denaturiert und mit DNA-Sonde gemischt. Die isotopenmarkierten DNA-Moleküle hybridisieren spezifisch mit der Ziel-DNA (Abb. 14.1).

Die nicht hybridisierte Sonden-DNA wird weggewaschen. Das Vorhandensein von Radioaktivität in der hybridisierten DNA kann durch Autoradiographie nachgewiesen werden. Dies zeigt das Vorhandensein eventuell gebundener (hybridisierter) Sondenmoleküle und damit der komplementären DNA-Sequenzen in der Ziel-DNA.

Nicht-radioaktives Detektionssystem:

Der Nachteil bei der Verwendung radioaktiver Markierungen besteht darin, dass die Isotope kurze Halbwertszeiten haben und Risiken bei der Handhabung bergen, außerdem erfordern sie eine spezielle Laborausrüstung. So wurden auch nicht-radioaktive Nachweissysteme (z. B. Biotinylierung) entwickelt. Biotin-markierte (biotinylierte) Nukleotide werden in die DNA-Sonde eingebaut. Das Nachweissystem basiert auf der enzymatischen Umsetzung eines chromogenen (farbgebenden) oder chemilumineszenten (lichtemittierenden) Substrats.

Das übliche Verfahren zum Chemilumineszenz-Nachweis von Ziel-DNA ist in Abb. 14.2 dargestellt. Eine mit Biotin markierte DNA-Sonde wird an die Ziel-DNA hybridisiert. Das Eiweißprotein Avidin oder sein bakterielles Analogon Streptavidin wird hinzugefügt, um an Biotin zu binden. Nun wird ein mit Biotin markiertes Enzym, wie alkalische Phosphatase, hinzugefügt, das an Avidin oder Streptavidin bindet. Diese Proteine ​​haben vier separate Biotin-Bindungsstellen.

Somit kann ein einzelnes Molekül (Avidin oder Streptavidin) sowohl an eine Biotin-markierte DNA-Sonde als auch an ein Biotin-markiertes Enzym binden. Bei Zugabe eines chemilumineszenten Substrats wirkt das Enzym alkalische Phosphatase und wandelt es in ein lichtemittierendes Produkt um, das gemessen werden kann.

Die mit Biotin markierte DNA ist bei Raumtemperatur etwa ein Jahr lang ziemlich stabil. Die Nachweisvorrichtungen, die Chemilumineszenz verwenden, werden bevorzugt, da sie genauso empfindlich sind wie der Nachweis von Radioisotopen und empfindlicher als die Verwendung von chromogenen Nachweissystemen.

PCR beim Einsatz von DNA-Sonden:

DNA-Sonden können erfolgreich zur Identifizierung von Ziel-DNAs aus verschiedenen Proben verwendet werden – Blut, Urin, Kot, Gewebe, Rachenspülungen ohne viel Reinigung. Der Nachweis der Zielsequenz wird ziemlich schwierig, wenn die DNA-Menge sehr gering ist. In einem solchen Fall wird zuerst die Polymerase-Kettenreaktion (PCR) verwendet, um die winzigen Mengen der Ziel-DNA zu amplifizieren und durch eine DNA-Sonde identifiziert zu werden.

DNA-Sonden und Signalverstärkung:

Die Signalamplifikation ist eine Alternative zur PCR zur Identifizierung kleinster DNA-Mengen unter Verwendung von DNA-Sonden. Bei der PCR wird die Ziel-DNA amplifiziert, während bei der Signalamplifikation die an die DNA-Sonde gebundene Ziel-DNA amplifiziert wird.

Es gibt zwei allgemeine Methoden, um eine Signalverstärkung zu erreichen.

1. Trennen Sie den DNA-Ziel-DNA-Sondenkomplex von den restlichen DNA-Molekülen und amplifizieren Sie ihn dann.

2. Amplifizieren Sie die DNA-Sonde (gebunden an die Ziel-DNA) mit einer zweiten Sonde. Als zweite Sonde kann die zur DNA-Sonde komplementäre RNA dienen. Der RNA-DNA-DNA-Komplex kann getrennt und amplifiziert werden. Üblicherweise wird das Enzym O-beta-Replicase verwendet, das die RNA-Replikation katalysiert.

Prinzip # 3. Das DNA-Chip-Mikroarray von Gensonden:

Der DNA-Chip oder Gen-Chip enthält Tausende von DNA-Sonden (4000.000 oder mehr), die auf einem kleinen Glasobjektträger von der Größe einer Briefmarke angeordnet sind. Durch diesen neuen und fortschrittlichen Ansatz können Tausende von Ziel-DNA-Molekülen gleichzeitig gescannt werden.

Technik zur Verwendung des DNA-Chips:

Die unbekannten DNA-Moleküle werden durch Restriktionsendonukleasen in Fragmente geschnitten. An diese DNA-Fragmente werden fluoreszierende Marker angehängt. Sie dürfen auf die Sonden des DNA-Chips reagieren. Ziel-DNA-Fragmente mit komplementären Sequenzen binden an DNA-Sonden. Die restlichen DNA-Fragmente werden weggewaschen. Die Ziel-DNA-Stücke können durch ihre Fluoreszenzemission identifiziert werden, indem ein Laserstrahl passiert wird. Ein Computer wird verwendet, um das Muster der Fluoreszenzemission und die DNA-Identifikation aufzuzeichnen.

Die Technik der Verwendung von DNA-Chips ist sehr schnell, außerdem ist sie empfindlich und spezifisch für die gleichzeitige Identifizierung mehrerer DNA-Fragmente. Wissenschaftler versuchen, Gen-Chips für das gesamte Genom eines Organismus zu entwickeln.

Anwendungen des DNA-Chips:

Die Anwesenheit von Mutationen in einer DNA-Sequenz kann bequem identifiziert werden. Tatsächlich wurde das Gen-Chip-Sonden-Array erfolgreich zum Nachweis von Mutationen in den p53- und BRCA-I-Genen verwendet. Beide Gene sind an Krebs beteiligt.


Wussten Sie, dass Ihr Genom etwa sechs Milliarden einzelne Bausteine ​​enthält – und dass wir jetzt die Reihenfolge all dieser Bausteine ​​in etwa einem Tag und für etwa 1000 US-Dollar lesen können? Technologiesprünge seit dem Humangenomprojekt haben bemerkenswerte genomische Fortschritte in Medizin, Landwirtschaft, Forensik und unserem Verständnis der Evolution ermöglicht.

Unser Genom (d. h. unser DNA-"Bauplan") - und tatsächlich die Genome aller Lebensformen auf der Erde - bestehen aus vier chemischen "Basen", die in unterschiedlicher Reihenfolge aneinandergereiht sind. Um die genaue Reihenfolge (oder Sequenz) der DNA einer Person zu untersuchen, folgen Forscher drei Hauptschritten: (1) die DNA reinigen und kopieren, (2) die Sequenz lesen und (3) mit anderen Sequenzen vergleichen.

Zuerst verwenden sie chemische Methoden zur Reinigung, dann "amplifizieren" sie bei einigen Menthoden die DNA in der Probe - das heißt, sie kopieren kleine Teile der Probe, um hoch genug für die Messung zu erreichen. Der Amplifikationsschritt ermöglicht DNA-Tests schon ab sehr kleinen Ausgangsmengen, wie etwa in forensischen Proben oder alten Knochen. Dann können verschiedene Methoden verwendet werden, um die Reihenfolge jeder Base in der DNA-Probe zu bestimmen. Schließlich vergleichen sie am Computer die Sequenz der DNA mit einer Referenzsequenz (zum Beispiel des menschlichen Genoms), um zu sehen, ob es Unterschiede in der Reihenfolge der Basen gibt.

Wussten Sie, dass Ihr Genom etwa sechs Milliarden einzelne Bausteine ​​enthält – und dass wir jetzt die Reihenfolge all dieser Bausteine ​​in etwa einem Tag und für etwa 1000 US-Dollar lesen können? Technologiesprünge seit dem Humangenomprojekt haben bemerkenswerte genomische Fortschritte in Medizin, Landwirtschaft, Forensik und unserem Verständnis der Evolution ermöglicht.

Unser Genom (d. h. unser DNA-"Bauplan") - und tatsächlich die Genome aller Lebensformen auf der Erde - bestehen aus vier chemischen "Basen", die in unterschiedlicher Reihenfolge aneinandergereiht sind. Um die genaue Reihenfolge (oder Sequenz) der DNA einer Person zu untersuchen, folgen Forscher drei Hauptschritten: (1) die DNA reinigen und kopieren, (2) die Sequenz lesen und (3) mit anderen Sequenzen vergleichen.

Zuerst verwenden sie chemische Methoden zur Reinigung, dann "amplifizieren" sie bei einigen Menthoden die DNA in der Probe - das heißt, sie kopieren kleine Teile der Probe, um ein für die Messung ausreichend hohes Niveau zu erreichen. Der Amplifikationsschritt ermöglicht DNA-Tests schon ab sehr kleinen Ausgangsmengen, wie etwa in forensischen Proben oder alten Knochen. Dann können verschiedene Methoden verwendet werden, um die Reihenfolge jeder Base in der DNA-Probe zu bestimmen. Schließlich vergleichen sie am Computer die Sequenz der DNA mit einer Referenzsequenz (zum Beispiel des menschlichen Genoms), um zu sehen, ob es Unterschiede in der Reihenfolge der Basen gibt.


Abschluss

Grundsätzlich verwenden Bioinformatiker leistungsstarke Computer, um große biologische Daten zu verarbeiten. Sie tun dies, indem sie Algorithmen und Datenbanken aufbauen und/oder verwenden.

Es hilft, die vier Omics zu kennen, die die Datensätze in der Bioinformatik generieren. Diese sind Genomik, Transkriptomik, Proteomik und Metabolomik. Genomik und Transkriptomik generieren Datensätze für die Bioinformatik über Hochdurchsatz-Sequenzierungstechnologien der nächsten Generation. Proteomik und Metabolomik generieren Datensätze aus Massenspektroskopie-Technologien.

Schließlich kann die Bioinformatik als eine Datenwissenschaft mit Biologiedomänenwissen betrachtet werden. Bei einem so weiten Feld wie der Bioinformatik besteht immer die Möglichkeit, etwas zu verpassen. Hier versuche ich, einen breiten Überblick über dieses Gebiet zu geben und die wichtigsten Teilgebiete darin abzudecken.


Was ist Bioinformatik?

Die Bioinformatik ist ein relativ neues Gebiet und daher wissen viele Menschen nicht genau, was „Bioinformatik“ wirklich ist.

„Forschung, Entwicklung oder Anwendung von Computerwerkzeugen und -ansätzen zur Ausweitung der Nutzung von biologischen, medizinischen, Verhaltens- oder Gesundheitsdaten, einschließlich derer, um solche Daten zu erfassen, zu speichern, zu organisieren, zu archivieren, zu analysieren oder zu visualisieren.“

Immer noch verwirrt? Keine Sorge, die meisten Leute sind es, wenn sie diese Definition hören. Normalerweise erzähle ich den Leuten gerne:

„Bioinformatik verbindet neueste Technologie mit biologischer Forschung.“

In den letzten zehn Jahren und sogar davor sind Computer zu einem festen Bestandteil jeder Branche geworden. Die biologische Forschung ist nicht anders. Die Computertechnologie hat die Geschwindigkeit, mit der Wissenschaftler biologische Daten erfassen und analysieren können, dramatisch beschleunigt. Die riesige Menge an Daten, die jeden Tag schneller produziert wird, hat neue Herausforderungen an die Branche gestellt, die das Speichern, Organisieren und Archivieren dieser Daten beinhalten. Die stark gestiegene Datenmenge hat auch den Bedarf an schnelleren und besseren Analyse- und Visualisierungstools mit sich gebracht. Jeder Bereich der Bioinformatik, von der Erfassung über die Speicherung bis hin zur Analyse der Daten, hat seine eigenen Herausforderungen, und es ist nicht ungewöhnlich, dass Fortschritte in einem Bereich den Fortschritt in einem anderen vorantreiben.

Um die Vielfalt der Bioinformatik besser zu verstehen, erfinden wir ein hypothetisches, aber interessantes Problem, das wir mit Hilfe der Bioinformatik angehen wollen:

Nehmen wir an, wir haben eine Bakterienart, die zu den normalen Millionen "guter" Bakterien gehört, die auf und in gesunden Menschen leben. Wir nennen diese Bakterien X.0. Eines Tages begannen Bakterien X, Menschen sehr krank zu machen. Was ist mit Bacteria X.0 passiert, um es zu dem schädlichen Bacteria X.1 zu machen? Schauen wir uns an, wie wir diese Frage mit Hilfe der Bioinformatik beantworten können und dabei Einblicke in die wunderbare Welt der Bioinformatik gewinnen.

Mit traditionellen molekularbiologischen Techniken isolieren wir Bakterien X und extrahieren ihre DNA. Dann „sequenzieren“ wir diese DNA. Setzen Sie das erste Glied in der Bioinformatik-Kette: Datenerfassung! Die Erfassung von Daten ist der Prozess der Generierung verwertbarer Daten aus einer biologischen Probe. In unserem Fall die Ableitung und Bestimmung der DNA-Sequenz des Bakterien-X-Genoms.

Das nächste Glied in der Kette speichert diese Sequenzdaten. Während bakterielle Genome typischerweise klein sind, können andere Genome, wie beispielsweise die des Menschen, Terabyte (1000 Gigabyte) an Daten produzieren.

Nun analysieren wir diese Sequenzdaten. Es gibt Leute, die sich auf die Entwicklung von Computerwerkzeugen zum Analysieren und Visualisieren von Daten spezialisiert haben, im Gegensatz zu Leuten, die die Informationen tatsächlich analysieren. Eine typische Analyse für unseren Beispielfall könnte darin bestehen, zunächst das Genom der ursprünglichen, harmlosen Bakterien X.0 grafisch zu visualisieren und mit dem Genom der neuen, schädlichen Bakterien X.1 zu vergleichen. Ein Wissenschaftler könnte in Bacteria X.1 ein DNA-Segment beobachten, das in der ursprünglichen Bacteria X.0 nicht vorhanden ist. Diese neue DNA-Region könnte für die schädlichen Auswirkungen verantwortlich sein, daher könnten die nächsten Analyseschritte darin bestehen, tiefer in diese Region vorzudringen und zu sehen, welche Gene dort liegen, welche Funktion diese Gene haben, woher sie kommen können usw .

[Denken Sie daran: Alle Annahmen und Schlussfolgerungen in diesem Beispiel sind hypothetisch und dienen nur zur Veranschaulichung.]

In diesem Beispiel sind wir auf mindestens 4 verschiedene Fachgebiete im Bereich der Bioinformatik gestoßen:

1) Datenbeschaffung (Arbeiten mit Maschinen und Geräten, DNA-Sequenzierung)
2) Speichern von Daten (normalerweise mit Datenbanken arbeiten)
3) Entwicklung von Tools zur Analyse und Visualisierung von Daten (Programmierung)
4) Daten analysieren (Statistik, Analyse)

In der Regel spezialisieren sich Einzelpersonen auf einen bestimmten Bereich, anstatt gleichzeitig in allen diesen Bereichen zu arbeiten. Das bedeutet, in Kombination mit all den verschiedenen Anwendungen der Bioinformatik, dass Sie 100 verschiedene „Bioinformatiker“ fragen könnten, was sie tun und 100 sehr unterschiedliche Antworten erhalten!

Bioinformatiktechniken werden heute in allen Bereichen der Biologie und Forschung eingesetzt, darunter Krebsforschung, Studien zur Optimierung des Ernteertrags, medizinische Genomik, Ökologie und Evolution. Das aufstrebende Gebiet des DNA-Barcoding kombiniert Labor- und Bioinformatiktechniken, um alle lebenden Arten zu katalogisieren und neue Arten zu identifizieren. Da die DNA die Blaupause des Lebens ist, kann die Bioinformatik auf jede Forschung mit lebenden Organismen (oder Organismen, die einst gelebt haben, siehe Ötzi der Mann aus dem Eis) angewendet werden.

Eines sollte man sich merken: Die vier oben beschriebenen Bereiche sind nicht so einfach, wie ich sie dargestellt habe. Zum Beispiel:

  • Wenn Sie eine Probe sequenzieren, sind Sie möglicherweise daran interessiert, RNA im Gegensatz zu DNA zu sequenzieren.
  • Vor der Analyse von Sequenzdaten muss die Qualität dieser Daten validiert werden. Manchmal müssen große Teile von Sequenzen „zusammengesetzt“ werden (z. B. „Genomassemblierung“). Beide Bereiche (Qualitätsanalyse und Genom-Assembly) sind sehr gefragte Spezialgebiete.
  • Neben der Sequenzierung kann die Datenanalyse auch riesige Mengen an neuen Daten generieren.

Das Gebiet der Bioinformatik verändert sich ständig und entwickelt sich schnell weiter. Techniken, die vor 2–3 Jahren neu waren, können heute umgekehrt sein, Techniken, die vor 2–3 Jahren unpraktisch waren, könnten heute beispielsweise dank der Fortschritte bei der Rechenverarbeitung von unschätzbarem Wert sein.

Egal, ob Sie sich für Pflanzen, Tiere, Bakterien, Pilze, Virologie, Genetik, Entwicklung von Datenbanken, Code schreiben, Statistik, Ingenieurwesen, Computerhardware oder Webtechnologien interessieren, im Bereich der Bioinformatik ist vielleicht ein Platz auf Sie zukommen .


Schau das Video: Klassische DNA-Sequenzierung nach Sanger (Dezember 2022).