Information

Frage zum DNA-Glycosylase-Enzymassay/Formamid-Gelladepuffer

Frage zum DNA-Glycosylase-Enzymassay/Formamid-Gelladepuffer


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Für den DNA-Glykosylase-Enzym-Assay können wir oft sehen, dass die DNA-Glykosylase mit Oligonukleotid bei 37 °C inkubiert wird und dann die Reaktion durch Zugabe von Formamid-Gelladepuffer (80% Formamid/1 mM EDTA, pH 8,0%,0,1% Bromphenolblau/ 0,1% Xylolcyanol). Wie wird die Reaktion durch diesen Puffer gestoppt?


Escherichia coli Endonuklease III (die ich jetzt als Nth bezeichnen werde) und das menschliche Homolog hNTH1 haben sowohl Glykosylase- als auch AP-Lyase-Aktivität. Der Abschnitt des Artikels, auf den Sie sich beziehen, beschreibt einen Assay der Lyase-Aktivität. Der Assay testete sowohl Nth und hNTH1 als auch HAP1, eine humane AP-Hydrolase, die 5' zur AP-Stelle spaltet. Bei diesem Assay wurde festgestellt, dass Nth und hNTH1 3' zur AP-Stelle spalten. HAP1 ist abhängig von $Mg^{2+}$ für katalytische Aktivität. hNTH1 (und wahrscheinlich Nth, angesichts der hohen Konservierung) sind abhängig von $Mg^{2+}$ für Substratspezifität (Eide et al., 2001). hNTH1 und Nth enthalten an $Fe-S$ Cluster, der an der DNA-Bindung beteiligt ist (Thayer et al., 1995).

Ursprünglich dachte ich, dass die Reaktion mit EDTA gestoppt wird. EDTA ist ein Chelatbildner; es bindet und maskiert Metallionen und verhindert deren Nutzung durch Enzyme. EDTA würde die Katalyse durch HAP1 und die DNA-Bindung durch Nth/hTNH1 verhindern.

Chris wies jedoch darauf hin, dass der Ladepuffer 1 mM EDTA enthält, während der Reaktionspuffer 5 mM&supmin; enthält $MgCl_2$. Obwohl das Papier nicht die zusammengemischten Volumina von Reaktions- und Ladepuffer angibt, ist es vielleicht unwahrscheinlich, dass die EDTA-Chelatbildung von $Mg^{2+}$ ist der einzige Mechanismus zum Stoppen der Reaktion. Die hohe Formamidkonzentration (80%) im Ladepuffer könnte dann dafür verantwortlich sein. Formamid wird üblicherweise zur Denaturierung von Nukleinsäuren verwendet und würde bei hohen Konzentrationen wahrscheinlich eine Wirkung auf die Enzymfunktion haben.

Verweise

Eide L, Luna L, Gustad EC, Henderson PT, Essigmann JM, Demple B, Seeberg E. 2001. Humane Endonuklease III wirkt bevorzugt auf DNA-Schäden gegenüber Guaninresten in DNA. Biochemie-US. 40(22):6653-6659

Thayer MM, Ahern H, Xing D, Cunningham RP, Tainer JA. 1995. Neuartige DNA-Bindungsmotive in der Kristallstruktur des DNA-Reparaturenzyms Endonuklease III. EMBO J. 14(16): 4108-4120.


Frage zum DNA-Glykosylase-Enzym-Assay/Formamid-Gel-Ladepuffer - Biologie

5-Formyluracil (fU) ist eine bedeutende Thymin-Läsion, die durch reaktive Sauerstoffradikale und photosensibilisierte Oxidation erzeugt wird. Wir haben zuvor gezeigt, dass fU aufgrund seiner erhöhten Häufigkeit von Fehlpaarungen mit Guanin eine potenziell mutagene Läsion ist. Daher kann fU in der DNA als richtig gepaarte fU:A-Form oder als falsch gepaarte fU:G-Form existieren. In dieser Arbeit wurde fU ortsspezifisch gegenüber A in Oligonukleotidsubstrate eingebaut, um den zellulären Reparaturmechanismus von fU gepaart mit A zu beschreiben. Die Reparaturaktivität für fU wurde in induziert Escherichia coli bei Exposition gegenüber n-Methyl-n′-Nitro-n-Nitrosoguanidin, und die Induktion war abhängig von der alkA Gen, was darauf hindeutet, dass AlkA (3-Methyladenin-DNA-Glycosylase II) für die beobachtete Aktivität verantwortlich war. Aktivitätsassays und Bestimmung kinetischer Parameter mit gereinigtem AlkA und definierten Oligonukleotidsubstraten, die fU, 5-Hydroxymethyluracil (hU) oder 7-Methylguanin (7 mG) enthielten, zeigten, dass fU von AlkA mit einer vergleichbaren Effizienz wie 7 mG erkannt wurde, ein gutes Substrat für AlkA, während hU, ein weiteres wichtiges Oxidationsprodukt von Thyminmethyl, kein Substrat war. 1 H- und 13 C-NMR-chemische Verschiebungen von 5-Formyl-2′-desoxyuridin zeigten an, dass die 5-Formyl-Gruppe einen Elektronenmangel von Base C-6 und Zucker C-1′ verursachte, was zu einer Destabilisierung des . führte n-glycosidische Bindung. Diese Merkmale sind in anderen guten Substraten für AlkA üblich und spielen vermutlich eine Schlüsselrolle bei der differenziellen Erkennung von fU, hU und intaktem Thymin. Drei bisher klonierte Säuger-Reparaturenzyme für alkylierte und oxidierte Basen (MPG, Nth1 und OGG1) erkannten fU nicht, was darauf hindeutet, dass die Säuger-Reparaturaktivität für fU auf einem noch nicht identifizierten Protein beruht. Im Begleitpapier (Terato, H., Masaoka, A., Kobayashi, M., Fukushima, S., Ohyama, Y., Yoshida, M. und Ide, H., J. Biol. Chem.-Nr. 274, 25144–25150), wird über mögliche Reparaturmechanismen für mit G fehlgepaarte fU berichtet.


Glyceraldehyd-3-phosphat-Dehydrogenase wird für die effiziente Reparatur von zytotoxischen DNA-Läsionen in Escherichia coli

Die Glyceraldehyd-3-Phosphat-Dehydrogenase (GAPDH) ist ein multifunktionales Protein mit vielfältigen biologischen Funktionen in menschlichen Zellen. Bei Bakterien sind mondscheinende GAPDH-Funktionen nur für das sezernierte Protein in Krankheitserregern oder Probiotika beschrieben. Auf intrazellulärer Ebene haben wir zuvor über die Interaktion von . berichtet Escherichia coli GAPDH mit Phosphoglycolat-Phosphatase, einem Protein, das am Stoffwechsel des DNA-Reparaturprodukts 2-Phosphoglycolat beteiligt ist, was auf eine mutmaßliche Rolle von GAPDH bei DNA-Reparaturprozessen schließen lässt. Hier liefern wir den Nachweis, dass GAPDH für die effiziente Reparatur von DNA-Läsionen in E coli. Wir zeigen, dass GAPDH-defiziente Zellen empfindlicher auf Bleomycin oder Methylmethansulfonat reagieren. In Zellen, die mit diesen genotoxischen Mitteln herausgefordert werden, führt ein GAPDH-Mangel zu einer verringerten Lebensfähigkeit der Zellen und zu einem filamentösen Wachstum. zusätzlich LückeA Die Knockout-Mutante akkumuliert eine höhere Anzahl spontaner abasischer Stellen und zeigt höhere spontane Mutationsfrequenzen als der Elternstamm. Pull-Down-Experimente mit unterschiedlichen genetischen Hintergründen zeigen eine Wechselwirkung zwischen GAPDH und Enzymen des Basenexzisions-Reparaturwegs, nämlich der AP-Endonuklease Endo IV und der Uracil-DNA-Glykosylase. Dieser Befund legt nahe, dass GAPDH eine Komponente eines Proteinkomplexes ist, der der Aufrechterhaltung der genomischen DNA-Integrität gewidmet ist. Unsere Ergebnisse zeigen auch eine Wechselwirkung von GAPDH mit dem einzelsträngigen DNA-Bindungsprotein. Diese Interaktion kann GAPDH an die Reparaturstellen rekrutieren und impliziert GAPDH in DNA-Reparaturwegen, die durch starke DNA-Schäden aktiviert werden, wie etwa homologe Rekombination oder die SOS-Antwort.


Frage zum DNA-Glykosylase-Enzym-Assay/Formamid-Gel-Ladepuffer - Biologie

Die Reparatur von apurinischen/apyrimidinischen (AP)-Stellen wird durch AP-Endonukleasen, wie das menschliche Ape1-Protein (auch als Hap1, Apex und Ref1 bezeichnet) initiiert. Dieses und verwandte Enzyme zeigen eine starke Abhängigkeit von zweiwertigen Kationen, insbesondere von Magnesium. Hier untersuchen wir die Rolle dieses Metalls in verschiedenen Stadien der Ape1-Reaktion: Substratbindung, Spaltung und Produktfreisetzung. Wir untersuchten die DNA-Bindung mit einem elektrophoretischen Ansatz und die DNA-Spaltung in Single-Turnover- und Steady-State-Reaktionen. Magnesium in niedrigen bis mittleren Konzentrationen beschleunigte sowohl die Substrat- als auch die Produktfreisetzung durch das Wildtyp-Ape1-Protein. Bei einem mutierten Ape1-Protein mit einer Aspartat-Alanin-Substitution am Rest 308 wurde das Substrat in vorgebildeten Protein-DNA-Komplexen im Gegensatz zum Wildtyp-Ape1 effizienter vor der Freisetzung gespalten, während die Produktfreisetzung dramatisch beschleunigt wurde. Die Magnesiumabhängigkeit von AP-Endonuklease-Reaktionen im Steady-State war sowohl für Wildtyp- als auch für das Aspartat-308-Alanin-Protein sigmoidal, jedoch nicht für ein Aspartat-283-Alanin-Derivat von Ape1. Diese Ergebnisse zeigen, dass Magnesium sowohl die DNA-Wechselwirkungen mit als auch die Phosphodiester-Spaltung durch Ape1 beeinflusst und den geschwindigkeitsbestimmenden Schritt der Reaktion verändern kann. Strukturstudien müssen im Kontext dieser vielfältigen Wirkungen des Metalls interpretiert werden.

Diese Arbeit wurde durch die Grants GM40000, CA71993 und ES03926 der National Institutes of Health unterstützt. Die Kosten für die Veröffentlichung dieses Artikels wurden teilweise durch die Zahlung von Seitengebühren bestritten. Der Artikel muss daher hiermit gekennzeichnet werden „Werbung“ gemäß 18 U.S.C. § 1734 nur, um auf diese Tatsache hinzuweisen.

Derzeitige Adresse: Abteilung für Entwicklungsbiologie und Onkologie, Forschungsinstitut für Strahlenbiologie und Medizin, Universität Hiroshima, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553, Japan.


MATERIALEN UND METHODEN

Chemikalien

[γ- 32 P]ATP (3000 Ci/mmol), [α- 32 P]dTTP (3000 Ci/mmol) und Sephadex G-25 Spin-Säule stammten von Amersham Biosciences, unmarkierte dNTPs stammten von Roche Molecular Biochemicals. Oligonukleotide stammten von Microsynth (Schweiz). Das THF (dSpacer) stammte von Glen Research. Alle anderen Reagenzien waren von analytischer Qualität und wurden von Merck oder Fluka bezogen.

Nukleinsäuresubstrate

Das 100mer Oligonukleotid, das die synthetische (THF) AP-Stelle enthält, sowie der komplementäre Strang und die entsprechenden Primer wurden chemisch synthetisiert und auf denaturierendem Polyacrylamidgel gereinigt. Die Sequenz von 100mer mit THF-Einheit ist wie folgt: 5′ATCCTGATTGCTATCTGAATATGGTGGTGGTGGGCGCCGGCG(X/G)TGTGAATTCGGCACTGGCCGTCATCGTGATCTATCTTACAGTATGCTCTTGGTTGTA3′

In Klammern ist die Position der 43 vom 5'-Ende entfernten Läsion oder des entsprechenden G-Restes in der unbeschädigten Matrize in Fettdruck angegeben (X, THF-Einheit). Dieses doppelsträngige Substrat wurde sowohl für die Einzelenzymassays als auch für das rekonstituierte LP-BER . verwendet in vitro. Alternativ wurden die Enden des Substrats mit Biotin blockiert, indem ein eine THF-Einheit enthaltender Strang an den komplementären Strang angelagert wurde, der Biotin am 3'- bzw. 5'-Ende enthielt. Für den pol-β-Assay enthielt das Substrat eine zusätzliche Lücke von 1 Nukleotid, für den Fen-1-Assay einen 10 nt-Flap (5'-ATCTGATCGC) und für Lig I einen Nick. Die Strukturen dieser Substrate sind in 1B dargestellt.

Proteine ​​und Substrate, die bei der Rekonstitution von Exzisionsreparaturen der langen Pflasterbasis verwendet werden in vitro.(EIN) Rekombinante Proteine ​​wurden wie in „Materialien und Methoden“ beschrieben gereinigt und auf einem 8–20 % Gradienten-SDS-PAGE-Gel aufgetrennt und mit Coomassie Blue gefärbt. Spur 1: Molekulargewichtsmarker Spur 2: APE 1 (2 µg) Spur 3: Pol β (2 µg) Spur 4: Fen 1 (2 µg) Spur 5: Lig I (2 µg) Spur 6: 9-1-1 Komplex (6 μg). (B) Schematische Darstellung der 32 P-5′-markierten Oligonukleotid-Substrate, die in der Studie verwendet wurden: ein 100 bp Duplex-Oligonukleotid mit einer THF-Einheit an Position 43 wurde für Reparaturreaktionen verwendet, die Enden des Substrats waren entweder frei (unblockiertes Substrat) oder mit einem Biotin an jedem Ende blockiert (blockiertes Substrat) ein 100 bp Duplex-Oligonukleotid mit einer 1 Nukleotid Lücke an der gleichen Position wurde für den Pol β Assay mit einem Nick für den Lig I Assay und mit einem 10 Nukleotid Flap für den Fen 1 . verwendet Reaktion

Proteine ​​und Substrate, die bei der Rekonstitution von Exzisionsreparaturen der langen Pflasterbasis verwendet werden in vitro.(EIN) Rekombinante Proteine ​​wurden wie in „Materialien und Methoden“ beschrieben gereinigt und auf einem 8–20 % Gradienten-SDS-PAGE-Gel aufgetrennt und mit Coomassie Blue gefärbt. Spur 1: Molekulargewichtsmarker Spur 2: APE 1 (2 µg) Spur 3: Pol β (2 µg) Spur 4: Fen 1 (2 µg) Spur 5: Lig I (2 µg) Spur 6: 9-1-1 Komplex (6 μg). (B) Schematische Darstellung der 32 P-5′-markierten Oligonukleotid-Substrate, die in der Studie verwendet wurden: ein 100 bp Duplex-Oligonukleotid mit einer THF-Einheit an Position 43 wurde für Reparaturreaktionen verwendet, die Enden des Substrats waren entweder frei (unblockiertes Substrat) oder blockiert mit einem Biotin an jedem Ende (blockiertes Substrat) ein 100 bp Duplex-Oligonukleotid mit einer 1 Nukleotid Lücke an der gleichen Position wurde für den Pol β Assay mit einem Nick für den Lig I Assay und mit einem 10 Nukleotid Flap für den Fen 1 . verwendet Reaktion

Proteine ​​und Antikörper

Humane AP-Endonuklease 1 wurde von Enzymax LLC bezogen. Rinderserumalbumin (BSA) wurde von New England BioLabs bezogen. Der 9-1-1-Komplex wurde isoliert, indem in Sf21-Zellen die drei Baculoviren, die das rekombinante hRad1, his-hRad9 und hHus1 kodieren, co-exprimiert wurden. Der Komplex wurde anschließend wie zuvor beschrieben gereinigt (39). Humanes PCNA wurde hergestellt in Escherichia coli unter Verwendung des Plasmids pT7/hPCNA und wie beschrieben bis zur Homogenität gereinigt (46). Humanes rekombinantes Pol β, Fen 1 und Lig I wurden in exprimiert E coli und gereinigt wie zuvor beschrieben ( 47–49). Die Anti-Hus1- und Anti-Rad9-Antikörper, die in Toueille et al. ( 39) waren ein Geschenk von R. Freire (Teneriffa, Spanien). Der Ziegen-Anti-Rad1-Antikörper (N18) sowie der Kaninchen-Anti-APE 1 (Anti-Ref1, H300)-Antikörper stammten von Santa Cruz Biotechnology.

Enzymatische Assays

AFFE 1 Inzisionsassay. Ein 100 bp Duplex-Oligonukleotid-Substrat wurde wie folgt hergestellt: Ein 100-mer Oligonukleotid, das eine THF-Einheit an der Position 43 enthielt, wurde an den komplementären Strang angelagert ( 1B ). Vor dem Annealing wurde ein eine Läsion enthaltender Strang am 5'-Ende mit T4-Polynukleotidkinase und [γ- 32 P]ATP markiert. Nicht eingebaute markierte Nukleotide wurden auf einer Sephadex G-25-Spin-Säule entfernt. APE 1-Schnittreaktionen wurden in einem Reaktionsgemisch (10 µl) mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . durchgeführt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol Oligonukleotid-Substrat und die angegebenen Mengen an APE 1. Die Enden des Oligonukleotid-Substrats waren entweder frei oder mit Biotin blockiert, wie in der angegeben Abbildung Legenden. Die Reaktionen wurden 20 min bei 37 °C inkubiert und durch Zugabe eines gleichen Volumens Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylencyanol) gestoppt. Nach einer Inkubation bei 100ºC für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die Wirkung des 9-1-1-Komplexes auf die Aktivität von APE 1 zu bestimmen, wurden die Reaktionen wie oben beschrieben durchgeführt, mit der Ausnahme, dass konstante Mengen von APE 1 in der Reaktionsmischung enthalten waren und eine steigende Menge von 9-1-1 Komplex wurden wie in Fig. 4A angegeben zugegeben.

Pol β Assay

Ein 42-mer-Oligonukleotid wurde am 5'-Ende radioaktiv markiert und mit einem stromabwärts gelegenen 57-mer-Oligonukleotid an den komplementären 100-mer-Strang angelagert. Das resultierende 32 P-markierte Duplex-Oligonukleotid hat eine 1-nt-Lücke an der Position 43 ( 1B ). Die Pol-β-DNA-Synthese wurde durch Messen der Nukleotid-Insertion in das oben beschriebene DNA-Substrat bestimmt. Die Reaktionen wurden in einem Endvolumen von 10 µl mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . durchgeführt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 &mgr;M dATP, dCTP, dGTP, dTTP, 50 fmol Oligonukleotid-Substrat mit Lücke und die angegebenen Mengen an Pol β. Die Reaktionen wurden 20 min bei 37 °C inkubiert und durch Zugabe eines gleichen Volumens Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylencyanol) gestoppt. Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht.

Pol β Aktivitätsassay auf dem läsionshaltigen Substrat

Die Pol-β-Aktivität auf dem 32 P-5'-markierten Duplex-Oligonukleotid-Substrat, das die THF-Einheit an Position 43 enthielt, wurde in Gegenwart einer konstanten Menge von APE 1 getestet. Die Reaktionen wurden 20 min bei 37 °C im Reaktionspuffer inkubiert (10 μl), das 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . enthielt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 μM dATP, dCTP, dGTP, dTTP, 50 fmol THF-haltiges Oligonukleotidsubstrat, 55,5 fmol APE 1 und die angegebenen Mengen an Pol β. Nach der Inkubation wurden die Reaktionen durch Zugabe eines gleichen Volumens Gelladepuffer (95 % Formamid, 20 mM EDTA, 0,02 % Bromphenolblau und 0,02 % Xylolcyanol) gestoppt, 5 min auf 100 °C erhitzt und die Produkte getrennt durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel und visualisiert durch Autoradiographie.

Fen 1 Endonuklease-Assay

Der Fen 1-Assay wurde wie beschrieben mit einigen Modifikationen durchgeführt ( 42). Um ein Flap-Substrat herzustellen, wurden 42- und 68-mer-Oligonukleotide an den komplementären 100-mer-Strang angelagert. Vor dem Annealing wurde ein 68-mer-Oligonukleotid am 3'-Ende mit terminaler Desoxynukleotidyltransferase und [α- 32 P]ddATP radioaktiv markiert. Ein so hergestelltes 32 P-markiertes Duplex-Oligonukleotid hatte einen 10-nt-Flap an der Position 43 ( 1B ). Der Fen 1-Spaltungsassay wurde in der Reaktionsmischung (10 µl) mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl&sub2;2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol Flap-Oligonukleotid-Substrat und die angegebenen Mengen an Fen 1. Die Reaktionen wurden bei 37 °C für 20 min inkubiert und durch Zugabe eines gleichen gestoppt Volumen Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylolcyanol). Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die stimulierende Wirkung des 9-1-1-Komplexes auf die Fen 1-Endonukleaseaktivität zu messen, wurden die Reaktionen unter den gleichen Bedingungen durchgeführt, außer dass konstante Mengen an Fen 1 im Reaktionspuffer vorhanden waren (25 fmol) und die angegebenen Mengen des 9-1-1-Komplexes wurden hinzugefügt, wie in 8C gezeigt.

Lig I Assay

Der Lig I-Assay wurde wie beschrieben mit Modifikationen (40) unter Verwendung von 42-mer- und 32 P-5'-markierten 58-mer-Oligonukleotiden durchgeführt, die an den komplementären 100-mer-Strang angelagert waren. Reaktionsmischungen (10 μl) enthielten 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol eines abgespaltenen Oligonukleotid-Substrats und die angegebenen Mengen Lig I. Die Reaktionen wurden bei 37 °C für 20 min inkubiert und durch Zugabe von &dgr; gleiches Volumen Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylolcyanol). Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die stimulierende Wirkung des 9-1-1-Komplexes auf die Lig I-Aktivität zu messen, wurden die Reaktionen unter den gleichen Bedingungen durchgeführt, außer dass konstante Mengen Lig I im Reaktionspuffer vorhanden waren (0,5 fmol) und die angegebenen Mengen an 9- 1-1-Komplex wurde zugegeben, wie in Fig. 8D angegeben.

Rekonstituiertes in vitro LP-BER

Der LP-BER-Assay wurde wie zuvor beschrieben mit Modifikationen (14, 50) durchgeführt. Die kompletten Reparaturreaktionen wurden im Reaktionspuffer (10 µl) durchgeführt, der enthielt: 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 μM dATP, dCTP, dGTP, dTTP und 50 fmol 32 P-5′-markiertes 100 bp Duplex-Oligonukleotidsubstrat mit einem THF an der Position 43. Die Enden des Oligonukleotidsubstrats waren entweder frei oder mit Biotin blockiert, wie in den Legenden der Figuren angegeben. Für die Rekonstitution von LP-BER unter Verwendung von unmarkiertem Substrat wurden die gleichen Bedingungen verwendet, mit der Ausnahme, dass die Konzentration von dTTP auf 8 μM reduziert wurde und [α- 32 P] dTTP (2.5 μCi) zu den Reaktionsmischungen zugegeben wurde. Die Reaktionen wurden durch die Zugabe von gereinigtem APE 1 (55 fmol), Pol β (64 fmol), Fen 1 (93 fmol) und Lig I (245 fmol) initiiert. Dem rekonstituierten LP-BER . wurden zunehmende Mengen des 9-1-1-Komplexes zugesetzt in vitro Reaktion unter Grenzbedingungen für jedes der vier Enzyme APE 1, Pol β, Fen 1 und Lig I (siehe „Ergebnisse“). Nach 20-minütiger Inkubation bei 37 °C wurden die Reaktionen durch Zugabe eines gleichen Volumens Gelladepuffer (95 % Formamid, 20 mM EDTA, 0,02 % Bromphenolblau und 0,02 % Xylolcyanol), erhitzt auf 100 °C, gestoppt 5 min, und die Endprodukte wurden durch Elektrophorese auf einem 10% denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht.

Pulldown-Assays

Für die His-Pulldowns wurden 6 µg des his-tagged 9-1-1 Komplexes bzw. der his-tagged Untereinheiten Rad9, Rad1 oder Hus1 mit 1 µg APE 1 für 2 h bei 4°C in Pulldown-Puffer [50 mM Tris-HCl (pH 8,0), 100 mM NaCl, 0,05% (v/v) NP-40]. Ni 2+ -Kügelchen, die zuvor durch Inkubation über Nacht in Pulldown-Puffer mit 5 mg/ml BSA beschichtet worden waren, gefolgt von drei Waschungen in Pulldown-Puffer, wurden dann zu den Proteinen gegeben. Anschließend wurden die Proben 1 h bei 4°C inkubiert. Nach fünfmaligem Waschen in Pulldown-Puffer mit 5 mM Imidazol wurden die Beads 5 min bei 95 °C in Laemmli-Puffer erhitzt und die co-präzipitierten Proteine ​​mittels Western-Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.

Für die APE-1-Sepharose-Pulldowns wurde gereinigtes APE 1 oder BSA, das als Negativkontrolle verwendet wurde, kovalent an CNBr-aktivierte Sepharose (Amersham Pharmacia Biotech) wie vom Lieferanten beschrieben in einem Endverhältnis von 1 μg Protein/μl . gekoppelt von Perlen. APE-1-Sepharose oder BSA-Sepharose (10 µl) wurden anschließend einmal in Pulldown-Puffer mit 10 mg/ml BSA und dreimal in Pulldown-Puffer gewaschen. Die Kügelchen wurden anschließend mit 300 ng his9-1-1-Komplex für 2 h in Pulldown-Puffer bei 4°C inkubiert. Nach fünfmaligem Waschen in Pulldown-Puffer wurden die Beads 5 min bei 95 °C in Laemmli-Puffer erhitzt und die copräzipitierten Proteine ​​mittels Western Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.

Ganzzellextrakte

Zur Herstellung von Gesamtzellextrakten wurden 7 × 10 6 293T-Zellen durch Trypsinierung gefolgt von Zentrifugation geerntet. Das Zellpellet wurde anschließend in Zelllysepuffer [50 mM Hepes-KOH, pH 7,5, 400 mM NaCl, 1 mM DTT, 2,5 mM MgCl&sub2;2, 20 % Glycerin, 0,5 % (v/v) NP40, 2 µg/ml Leupetpin, 1 µg/ml Bestatin, 1 µg/ml Pepstatin, 2 mM PMSF, 10 mM Glycerophosphat, 1 mM NaF, 10 mM Na4P2Ö7] für 15 min bei 4°C. Anschließend wurde das Zelllysat 15 min bei 10000 rpm zentrifugiert, der Überstand gesammelt und als Gesamtzellextrakt aufbewahrt. Die Proteinkonzentration wurde unter Verwendung des Bradford-Assays bestimmt.

Immunpräzipitationen

Für Immunpräzipitationen wurden 25 µl Protein G-Sepharose 3 Stunden bei 4 °C mit 100 µg BSA in IP-Puffer (40 mM Hepes-KOH, pH 7,5, 100 mM NaCl, 8 mM MgCl .) beschichtet2, 2 µg/ml Leupetpin, 1 µg/ml Bestatin, 1 µg/ml Pepstatin, 2 mM PMSF, 10 mM Glycerophosphat, 1 mM NaF, 10 mM Na4P2Ö7) und anschließend über Nacht mit 3 µg anti-Rad9-Antikörper oder dem unimmunisierten Kaninchen-IgG inkubiert. Nach dreimaligem Waschen in IP-Puffer wurden die Kügelchen mit 1 mg 293 T Gesamtzellextrakt für 3 h bei 4°C inkubiert. Nach der Inkubation wurden die Kügelchen dreimal in IP-Puffer, der 0,05% NP40 enthielt, gewaschen und anschließend für 5 Minuten bei 95 °C in Laemmli-Puffer erhitzt. Die copräzipitierten Proteine ​​wurden mittels Western Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.


ERGEBNISSE

Echtzeit-Helikase-Assay

Fluoreszenz ist eine empfindliche Technik, die den klaren Vorteil hat, einen Reaktionsprozess in Echtzeit, bei niedriger Konzentration und bei hohem Durchsatz zu überwachen. Aus diesem Grund wurde der Helicase-Assay entwickelt, um den Abwickelprozess eines fluorophormarkierten DNA-Systems zu überwachen. Pif1-Helikasen translozieren in 5′-zu-3′-Richtung und benötigen einen 5′-Schwanz, um ihr Substrat zu beladen (2, 22). Daher haben wir das DNA-System so konstruiert, dass es dieses Erkennungselement enthält (Abbildung 1). Eine einzelsträngige 5′-Region von 11 Desoxyadeninen wurde verwendet, um die erforderliche Pif1p-Andockstelle zu erzeugen. Basierend auf früheren in vitro Studien von Pif1, 11 Nukleotide sind ausreichend für die Pif1p-Beladung (23). Das Substrat enthält auch eine G4-bildende Region (Tabelle 1) und einen 3'-Schwanz von 17 Nukleotiden, der an seinem 3'-Ende kovalent an einen Dabcylrest gebunden ist. Ein an seinem 5'-Ende mit dem FAM-Fluorophor markiertes komplementäres Oligonukleotid wird an 15 Nukleotide auf der 3'-Seite des Dabcyl-markierten Oligonukleotids angelagert, wodurch ein doppelsträngiges Substrat gebildet wird. Bei diesem Design trennen zwei Nukleotide die G4-bildende Sequenz von der Duplexeinheit. Diese Spacer-Nukleotide sind notwendig, um eine Destabilisierung der G4-Struktur bei der Bildung der Duplexstruktur zu vermeiden, aber es wird nicht erwartet, dass sie eine Andockstelle für Pif1 bereitstellen. Außerdem löscht in diesem System das Dabcyl die Fluoreszenz von FAM, wenn der Duplex gebildet wird. Die Helikase belädt zuerst den 5'-Schwanz und entwickelt nach ATP-Zugabe die G4-Struktur und dann die fluoreszenzmarkierte Duplex-DNA. Dadurch wird die FAM-markierte Sonde vom Dabcyl-markierten Strang freigesetzt, was zu einem messbaren Fluoreszenzanstieg der FAM-Sonde führt.

Illustration der Helikase-Reaktion mit dem G4/Duplex-DNA-System. Das Substrat weist eine einzelsträngige Region, eine G4-Region und eine Duplex-Region auf. Bei der Duplexbildung wird die Fluoreszenz des FAM (oranges Symbol), das den Einzelstrang markiert, gelöscht. Im ersten Reaktionsschritt bindet die Pif1p-Helikase an das 5'-Einzelstrangende. Nach der ATP-Zugabe schreitet die Helikase in 5'- nach 3'-Richtung fort und entwindet zuerst die G-Quadruplex-Struktur und dann die Duplex-DNA. Das Aufwickeln des Duplexes setzt die markierte einzelsträngige Sonde frei, die eine starke Fluoreszenz emittiert, da sie nicht mehr durch Dabcyl (violettes Symbol) auf dem komplementären Strang gelöscht wird.

Illustration der Helikase-Reaktion mit dem G4/Duplex-DNA-System. Das Substrat weist eine einzelsträngige Region, eine G4-Region und eine Duplex-Region auf. Bei der Duplexbildung wird die Fluoreszenz des FAM (oranges Symbol), das den Einzelstrang markiert, gelöscht. Im ersten Reaktionsschritt bindet die Pif1p-Helikase an das 5'-Einzelstrangende. Nach der ATP-Zugabe schreitet die Helikase in 5'- nach 3'-Richtung fort und entwindet zuerst die G-Quadruplex-Struktur und dann die Duplex-DNA. Das Aufwickeln des Duplexes setzt die markierte einzelsträngige Sonde frei, die eine starke Fluoreszenz emittiert, da sie nicht mehr durch Dabcyl (violettes Symbol) auf dem komplementären Strang gelöscht wird.

Zur Validierung des Assays und zur Optimierung der benötigten DNA- und Enzymmenge wurden zwei verschiedene Substrate getestet. In einem ersten Bau des cmyc G4, eine 16-mer-Sequenz, die aus einer mutierten Version des 3'-Teils des NHEIII-Promotors von c-MYC entworfen wurde, wurde in die DNA-Assembly aufgenommen (S-cmyc Auslegung, Tabelle 1). Diese mutierte Sequenz faltet sich zu einer weniger polymorphen und homogeneren G4-Struktur als die natürliche c-MYC-Sequenz. Es nimmt in Gegenwart einwertiger Kationen eine parallele G4-Struktur an, die im S-cmyc (Ergänzende Abbildung S1). In einer zweiten Konstruktion wurden mehrere Guanine im mutiert c-myc Sequenz, um die Bildung einer stabilen G4-Struktur zu verhindern. So folgt in diesem System einer langen Einzelstrangregion der kurze DNA-Duplex (Schmutz Auslegung, Tabelle 1).

Pif1 ist in Gegenwart von entweder Na + oder K + aktiv, die optimale Konzentration einwertiger Kationen beträgt 50–60 mM, aber Pif1 ist bei höherer Ionenstärke (100 mM) immer noch hoch aktiv ( 23). Mehrere Konzentrationen von Pif1 wurden in einem Puffer mit 1 mM KCl und 99 mM NaCl unter Verwendung des S-cmyc System. Die Zugabe von ATP zu dieser Lösung aktivierte das Helikase-Enzym, was zur Freisetzung des FAM-markierten Einzelstrangs führte ( 2A ). Die beobachtete maximale Emission und die Kinetik der Reaktion waren direkt von der Enzymkonzentration abhängig, wobei eine maximale Enzymaktivität bei einer Pif1-Konzentration von 12 nM erreicht wurde (Abbildung 2B). Ähnliche Experimente wurden in einem Puffer durchgeführt, der 100 mM KCl enthielt. Bei dieser KCl-Konzentration beobachteten wir keine Fluoreszenzverstärkung, was darauf hindeutet, dass entweder die Helikase in KCl bei dieser Ionenstärke inaktiv ist oder dass cmyc G4 zu stabil ist, um von Pif1 abgewickelt zu werden. Um zwischen diesen beiden Möglichkeiten zu unterscheiden, wurde ein ähnliches Experiment mit dem Schmutz System, das keine G4-Struktur bilden kann. Wir fanden in beiden Puffern fast ähnliche Fluoreszenzemissionsverstärkungen (1 mM KCl/99 mM NaCl und 100 mM KCl, ergänzende Abbildung S2) . Somit war der Aktivitätsunterschied das Ergebnis eines Unterschieds in der Stabilität des zu entfaltenden G4-Substrats. Dies ist der erste Nachweis, dass ein stabiles intramolekulares G4 der Entfaltung durch die Pif1-Helikase widerstehen kann.

(EIN) Echtzeit-Emissionsverbesserung von S-cmyc als Funktion der Pif1p-Konzentration. Pif1p-Helikase wurde bei mehreren Konzentrationen (3, 6, 12, 25, 50 und 100 nM) mit dem Quadruplex-Duplex . inkubiert S-cmyc (40 nM) in einem 1 mM KCl/99 mM NaCl-Puffer. Die Emission wurde über die Zeit nach der ATP-Zugabe überwacht. (B) Maximale Emissionssteigerung erreicht für S-cmyc System nach ATP-Zugabe als Funktion der Pif1-Konzentration. Fehlerbalken zeigen die Standardabweichung von drei unabhängigen Experimenten an.

(EIN) Echtzeit-Emissionsverbesserung von S-cmyc als Funktion der Pif1p-Konzentration. Pif1p-Helikase wurde bei mehreren Konzentrationen (3, 6, 12, 25, 50 und 100 nM) mit dem Quadruplex-Duplex . inkubiert S-cmyc (40 nM) in einem 1 mM KCl/99 mM NaCl-Puffer. Die Emission wurde über die Zeit nach der ATP-Zugabe überwacht. (B) Maximale Emissionssteigerung erreicht für S-cmyc System nach ATP-Zugabe als Funktion der Pif1-Konzentration. Fehlerbalken zeigen die Standardabweichung von drei unabhängigen Experimenten an.

Für weitere Studien in dieser Forschung wurde die willkürliche 1 mM KCl/99 mM NaCl-Pufferlösung ausgewählt. Es wurde gefunden, dass diese K/Na-Mischung ein guter Kompromiss ist, um eine optimale Aktivität des Proteins zu ermöglichen, während die Quadruplexstruktur richtig gefaltet ist. Eine Erhöhung der Konzentration von K + auf eine physiologische Konzentration (~150 mM) würde die G4-Struktur signifikant stabilisieren, was größere Enzymmengen erfordert. Darüber hinaus würde eine hohe Konzentration an Monokationen die in vitro Aktivität der Helikase (die bei 50–60 mM Monokationen optimal ist).

In unserem System steht die Entwindungsreaktion in Konkurrenz zur Rehybridisierung der beiden getrennten Stränge, die entweder spontan erfolgt oder durch die Helikase selbst gefördert wird (24). Die Neubildung der Duplex-DNA ist langsam, aber nicht vernachlässigbar, selbst bei geringer Strangkonzentration (40 nM). Es wurde in den Abwickelspuren nach wenigen Minuten beobachtet (Ergänzungsabbildung S3). Die Helikaseaktivität von Pif1 erreicht ihr Maximum unmittelbar nach der ATP-Zugabe, jedoch nimmt die Aktivität des Enzyms nach wenigen Minuten ab und die Duplexbildung führt zur Emissionslöschung des FAM-Fluorophors, ein Phänomen, das in Echtzeit beobachtet werden kann. Um diese Einschränkung zu überwinden, argumentierten wir, dass die Zugabe eines einfangenden Oligonukleotids zum Reaktionsgemisch ein Duplex-Reannealing verhindern würde (25). Ein kurzes einzelsträngiges Oligonukleotid (Fangen) vollständig komplementär zum FAM-markierten Strang wurde dem Reaktionsgemisch zugesetzt. Sobald das Enzym die Duplexstruktur entwindet, wird erwartet, dass die einzelsträngige FAM-Sequenz durch den nicht markierten komplementären Strang eingefangen wird. Dies haben wir beobachtet, da ein kleiner Überschuss dieses Trapper-Oligonukleotids auch nach 30 min zu einer stabilen Fluoreszenz führte (Ergänzende Abbildung S3).

Der nächste Schritt in dieser Forschung war die Quantifizierung der enzymatischen Aktivität. Um die maximale Fluoreszenzemission des abgewickelten Substrats zu messen, muss eine vollständige Trennung des FAM-Dabcyl-markierten Duplex erreicht werden. Zu diesem Zweck wurde ein zweiter Einfangschritt eingeführt. Sobald die Helikase-Reaktion abgeschlossen war und die Fluoreszenzemission ein stabiles Plateau erreichte, wurde ein Oligonukleotid komplementär zur vollständigen Dabcyl-markierten Sequenz (C-mut) wurde in die Reaktion eingeführt. Dieser DNA-Strang verdrängt die FAM-markierte Sequenz in jedem nicht umgesetzten G4-Duplexsystem, was in einem quasi-irreversiblen Prozess zu einer hochstabilen Duplex-DNA (44 bp lang) führt (siehe ergänzende Abbildung S4). Abbildung 3 zeigt eine Illustration dieser zweistufigen Reaktion für die S-cmyc System. Der erste Schritt beinhaltet eine Helikase-vermittelte Trennung von G4/Duplex und ist ATP-abhängig. Sobald die Reaktion ein stabiles Plateau erreicht, wird die Addition der komplementären Sequenz C-cmyc treibt die Reaktion an, indem es jedes nicht reagierte G4-dx-System verdrängt, wobei dieser zweite Schritt ATP-unabhängig ist. Somit ist die Pif1-Helikaseaktivität auf dem S-cmyc Substrat kann durch Vergleich der Fluoreszenzemission in der ersten und zweiten Stufe der Reaktion berechnet werden.

(oben) Illustration der zweistufigen Helikase-Reaktion, von der angenommen wird, dass sie im S-cmyc System. Im ersten Schritt wickelt die Pif1p-Helikase nach Zugabe von ATP den G4/Duplex ab und gibt die markierte einzelsträngige Sonde frei. Im zweiten Schritt wird der Dabcyl-komplementäre Strang C-cmyc hinzugefügt wurde, verdrängt dies jeglichen verbleibenden Duplex, was zu dem maximal möglichen Emissionssignal führt. (unten) Abwickelvorgang in Echtzeit überwacht durch Aufzeichnung der Emissionssteigerung des FAM-gekennzeichneten Systems.

(Oben) Illustration der zweistufigen Helikase-Reaktion, von der angenommen wird, dass sie im S-cmyc System. Im ersten Schritt wickelt die Pif1p-Helikase nach Zugabe von ATP den G4/Duplex ab und gibt die markierte einzelsträngige Sonde frei. Im zweiten Schritt wird der Dabcyl-komplementäre Strang C-cmyc hinzugefügt wurde, verdrängt dies jeglichen verbleibenden Duplex, was zu dem maximal möglichen Emissionssignal führt. (unten) Echtzeitüberwachung des Abwickelvorgangs durch Aufzeichnung der Emissionssteigerung des FAM-gekennzeichneten Systems.

Die Einfachheit und Schnelligkeit dieses Tests ermöglicht die Abstimmung der Pufferbedingungen sowie der Oligonukleotid- und Helikasekonzentrationen, um den Assay für eine andere Helikase oder verschiedene G4-Substrate zu optimieren. Die Helikase-Reaktion für die S-cmyc System wurde in einem Puffer durchgeführt, der 1 mM KCl und 99 mM NaCl enthielt. Die physiologisch relevante Anwesenheit von 100 mM KCl stabilisierte die c-myc G4-Motiv im S-cmyc System und führte zu einem Hindernis für das Enzym. Um die Vielseitigkeit dieses Tests zu beweisen, wurden die Helicase-Assay-Bedingungen für die S-cmyc System bei 100 mM KCl. Wie in 4 gezeigt, war die Erhöhung der Pif1-Konzentration von 20 nM (was eine sättigende Enzymkonzentration in einem 1 mM KCl/99 mM NaCl-Puffer war) auf 100 nM ausreichend, um die Helikaseaktivität in diesem System wiederherzustellen.

Helicase-Aktivität gegen die S-cmyc DNA-System in Puffer mit 100 mM KCl bei 20, 40, 100 und 200 nM Pif1. Fehlerbalken zeigen die mittlere Abweichung zwischen zwei unabhängigen Experimenten an.

Helicase-Aktivität gegen die S-cmyc DNA-System in Puffer mit 100 mM KCl bei 20, 40, 100 und 200 nM Pif1. Fehlerbalken zeigen die mittlere Abweichung zwischen zwei unabhängigen Experimenten an.

Der Entwindungsprozess eines Duplex-Motivs unmittelbar nach einer Quadruplex-Struktur durch die Wirkung der Pif1-Helikase wurde kürzlich von (19) untersucht. In einem Einzelmolekül-FRET-Assay fanden sie, dass die Pif1-Helikase eine Duplexstruktur nicht auflösen konnte, wenn ihnen ein Quadruplex-Motiv vorausging. Da diese Helikase in der Lage ist, die S-cmyc System, das dem Substrat von Zhou relativ ähnlich ist, wurde ein neues Design vorgeschlagen, um die besonderen Unterschiede zwischen dem Design von Zhou und dem im vorliegenden Helikase-Assay vorgeschlagenen Design zu verifizieren. Die Pif1-Helikaseaktivität in einer Konstruktion, die aus einem Duplex-Motiv gefolgt von einem Einzelstrang, einem Quadruplex-Motiv und einem zweiten Duplex besteht (Ergänzende Abbildung S5), wurde unter den gleichen Bedingungen wie zuvor für den Helikase-Assay beschrieben untersucht. Interessanterweise war Pif1 in der Lage, sowohl das Quadruplex- als auch das Duplex-Motiv, das folgt, aufzuwickeln, und zeigte somit ein anderes Verhalten als in Zhous Studie. Dieser Verhaltensunterschied ist daher auf Unterschiede zwischen den beiden experimentellen Designs (Einzelmolekül- versus Volumenreaktion mit Abfangen) und nicht auf ein Sequenzartefakt zurückzuführen (siehe Diskussion).

G-Quadruplex-Struktur-Screening

Unter Verwendung des zweistufigen Assays wurde eine Reihe von G4-Strukturen auf ihre Fähigkeit zur Hemmung von Pif1 gescreent. Zwei nicht-G4-haltige Systeme wurden ebenfalls als Kontrollen eingeschlossen (Tabelle 1): Das erste war das zuvor beschriebene einzelsträngige Schmutz System und das zweite war das S-dx System, das durch die Schmutz System, zu dem ein unmarkiertes 17-Nukleotid-Oligonukleotid hinzugefügt wird, das komplementär zu der mutierten G-reichen Region ist. Das erste Kontrollsubstrat ist einzelsträngig, während das zweite einen Duplex beinhaltet. Die gescreente Serie von G4-Sequenzen umfasste eine Reihe gut charakterisierter G4-Strukturen (Tabelle 1): S-htelo, die menschliche Telomer-DNA h-telo Sequenz ( 26) S-cmyc, S-ckit1, S-ckit2 und S-Kras Systeme enthalten diese G4-Sequenzen, die sich in den Promotorregionen bekannter Onkogene befinden (c-myc ( 27), c-kit1 ( 28), c-kit2 ( 29) und 27Kras ( 30) bzw.) S-CEB, enthält die G-reiche Region des Minisatelliten CEB25 ( 31) S-TBA, das thrombinbindende Aptamer TBA Sequenz ( 32) S-CTA, enthaltend die humane telomerische Variante CTA (33). Mit Ausnahme von S-TBA Substrat, zeigten alle vorgeschlagenen Systeme unter den für diesen Test berücksichtigten Pufferbedingungen eine Quadruplex-Struktur (Ergänzende Abbildung S1). Das System S-TBA konnte sich jedoch nicht zu einer stabilen Quadruplex-Struktur falten. TBA Quadruplex ist ein Quadruplex, der nur aus zwei G-Tetraden gebildet wird und eine geringe Stabilität aufweist, daher das Vorhandensein einer langen Poly(dA)-Sequenz am 5′-Terminus und eines Duplex-Motivs am 3′-Ende (S-TBA Design) kann sich nachteilig auf die G4-Bildung auswirken.

5A zeigt Daten aus einem repräsentativen zweistufigen Helikase-Assay, der die Wirkung von Pif1 auf G4-Sequenzen in Echtzeit in 1 mM KCl und 99 mM NaCl überwacht. Die Zugabe von ATP zu der Lösung von Enzym und DNA aktivierte Pif1 und führte zur Entwindung des DNA-Duplex, was zu einer Erhöhung der Fluoreszenzemission führte. Nach 30 min war in allen Fällen ein stabiles Plateau der Fluoreszenzemission erreicht. Nach 30 min wurde der komplementäre Strang jeder Dabcyl-markierten Sequenz hinzugefügt. Dies führte zur vollständigen Entfaltung aller G4-Strukturen und zur Verdrängung der FAM-markierten Sequenz. Die vollständige Freisetzung der FAM-markierten Stränge führte zu der mit jedem System maximal möglichen Emission. Rohdaten für jedes einzelne System werden in der ergänzenden Abbildung S6 bereitgestellt.

(EIN) Repräsentative Diagramme der Emission als Funktion der Zeit für das Abwickeln ausgewählter DNA-Systeme (Schmutz, S-dx, S-cmyc, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S-Kras und S-CTA). ATP wurde zugegeben, um die Reaktion zu starten (t = 0 min) die komplementären Stränge (C-mut, C-cmyc, C-htelo, C-ckit1, C-ckit2, C-TBA, C-CEB, C-Kras und C-CTA) wurden zugegeben, sobald die Reaktionen ein Plateau erreichten (t = 30 min). (B) Die Quantifizierung der Pif1p-Helikase-Aktivität gegenüber ausgewählten DNA-System-Fehlerbalken zeigt die Standardabweichung von drei unabhängigen Experimenten an.

(EIN) Repräsentative Diagramme der Emission als Funktion der Zeit für das Abwickeln ausgewählter DNA-Systeme (Schmutz, S-dx, S-cmyc, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S-Kras und S-CTA). ATP wurde zugegeben, um die Reaktion zu starten (t = 0 min) die komplementären Stränge (C-mut, C-cmyc, C-htelo, C-ckit1, C-ckit2, C-TBA, C-CEB, C-Kras und C-CTA) wurden zugegeben, sobald die Reaktionen ein Plateau erreichten (t = 30 min). (B) Die Quantifizierung der Pif1p-Helikase-Aktivität gegenüber ausgewählten DNA-System-Fehlerbalken zeigt die Standardabweichung von drei unabhängigen Experimenten an.

5B zeigt die quantifizierte Pif1-Helikaseaktivität in Gegenwart jeder untersuchten Struktur. Unter diesen Bedingungen konnte keine der G4-Strukturen die Helikaseaktivität des Pif1-Enzyms vollständig blockieren. Nichtsdestotrotz war das Vorhandensein stabiler G4-Strukturen in einigen Aggregaten ein Hindernis für das Enzym, und daher war die Entwindungsaktivität leicht reduziert, wie durch Vergleich der Emissionsintensitäten nach dem ersten und zweiten Reaktionsschritt festgestellt wurde. Die meisten der kinetischen Profile waren hyperbolisch, mit Ausnahme derer, die mit den beiden c-kit-Sequenzen erhalten wurden, die sigmoidal waren. Diese Sequenzen bildeten Strukturen höherer Ordnung, die während der Elektrophorese nicht in ein Gel eintraten (ergänzende Abbildung S7). Das Vorhandensein dieser vermutlich intermolekularen Strukturen höherer Ordnung könnte dieses Verhalten erklären. Die beobachtete Kurve für S-Kras G4-Substrat, das auch die Bildung von Strukturen höherer Ordnung zeigt (Ergänzende Abbildung S7), war jedoch nicht sigmoidal.

Es überrascht nicht, dass die einzelsträngige Schmutz war die reaktivste Baugruppe und das Abwickeln war fast vollständig (90 %). Ebenso die TBA Es wurde gefunden, dass das Substrat, das ein relativ instabiles G4-Motiv enthält, das durch Stapeln von nur zwei Guanin-Quartetten gebildet wurde, zu 90 % ungefaltet war. Pif1 wickelte die anderen G4-Strukturen mit Wirkungsgraden von 65–85% ab. Interessanterweise ist die 17 Basenpaare lange Duplex-DNA in der S-dx Design war das stärkste Hindernis für das Pif1-Protein der bei 1 mM K + -Konzentration getesteten Strukturen. Dies bestätigt frühere Berichte mit intermolekularen G4-Strukturen, die zeigten, dass Pif1 G4-Strukturen effizienter auflösen kann als Duplex-DNA-Strukturen in vitro ( 10, 15).

Die Stabilität von DNA-Substraten gegen das Pif1-Enzym wurde mit der thermischen Stabilität der Quadruplex-Einheitsstruktur verglichen. Zu diesem Zweck wurde für jedes System die Tm des Quadruplex-Kernmotivs bestimmt. Eine genaue Tm-Bestimmung der im Gesamtsystem eingebetteten G4-Struktur war schwierig, da die Einzelstrang- und Duplexüberhänge zur Absorption beitrugen und das Signal verfälschten. Die Tm der Quadruplex-Kernstrukturen zeigte einen ähnlichen Stabilitätstrend wie im Helikase-Assay (ergänzende Abbildung S8). Die Tm der S-cmyc-, S-htelo- und S-CTA-Quadruplex-Kernmotive, die den DNA-Systemen entsprechen, die eine höhere Barriere für das Enzym darstellen, zeigten die höchsten Tm-Werte (59,9°C, 56,8°C .). bzw. 57,9°C). Im Gegensatz dazu erwies sich der TBA-Quadruplex-Kern als am wenigsten thermodynamisch stabil (29,5 °C).

Um die Vielseitigkeit dieses Tests zu testen, S-htelo Das System wurde auch unter physiologischeren [K + ]-Bedingungen untersucht. Wie zuvor gezeigt für S-cmyc (Abbildung 4) verhindert die Anwesenheit einer höheren Menge an Kaliumkationen die Entwindung von Pif1p, was durch eine Erhöhung der Enzymkonzentration in der Reaktion überwunden werden kann. Dies deutet wiederum darauf hin, dass eine hohe K + -Konzentration den Quadruplex stabilisiert, sodass die optimale Enzymkonzentration zum Abwickeln des Quadruplex in diesem Puffer höher ist (Abbildung 4).

Quadruplex-Liganden-Screening

Die Entwindung von G4-Strukturen durch Pif1 wurde weiter untersucht, indem die Stabilität des G4-Motivs unter Verwendung bekannter G4-Liganden erhöht wurde. Vier gut charakterisierte G4-Liganden wurden evaluiert: die trisubstituierte Acridin-Verbindung Braco-19 ( 34), das Bischinolinium PhenDC3 ( 35), das Bis(chinolinyl)pyridin Pyridostatin ( 36) und Triazoniatrinaphthylen TrisQ ( 37) (Abbildung 6). Die G4-haltigen DNA-Systeme, die Schmutz (als Beispiel für ein Substrat, das unstrukturierte einzelsträngige DNA anstelle eines Quadruplex-Motivs enthält), und die S-dx Design (als Beispiel für eine Duplexstruktur) wurden im Hochdurchsatzformat in Gegenwart und Abwesenheit jedes Liganden unter Verwendung der zweistufigen Assay-Strategie getestet. Abbildung 6A und B zeigen Echtzeit-Abwickelkurven von Schmutz und S-cmyc von Pif1 in Gegenwart und Abwesenheit von Liganden. Mit Ausnahme von Braco-19 die die Aktivität des Enzyms verlangsamte, beeinflusste die Anwesenheit von G4-Liganden im Reaktionsmedium die Abwickelaktivität von Pif1 auf die Schmutz Substrat. Dies war zu erwarten, da die ausgewählten Liganden G4-Strukturen binden, aber keine Duplex- oder einzelsträngige DNA (ergänzende Abbildung S9). Braco-19 zeigten in diesen beiden Systemen eine schwache Hemmung der Pif1-Aktivität, und diese Abnahme wurde einer Änderung der Reaktionskinetik zugeschrieben. Die Pif1-Aktivität wurde auf der S-cmyc Substrat, wenn einer der G4-Binder vorhanden war, was darauf hindeutet, dass die Bildung eines G4-Ligandenkomplexes die Entwindung durch das Enzym hemmt.

Typische Echtzeit-Entfaltung von (EIN) S-cmyc und (B) Schmutz Systeme in Abwesenheit oder Gegenwart ausgewählter Liganden (Braco19 ( 34), Pyridostatin ( 36), Phen DC3 ( 35) und TrisQ ( 37)). ATP wurde bei t = 0 dem komplementären Strang hinzugefügt (C-mut und C-cmyc) wurde bei t = 45 min zugegeben.

Typische Echtzeit-Entfaltung von (EIN) S-cmyc und (B) Schmutz Systeme in Abwesenheit oder Gegenwart ausgewählter Liganden (Braco19 ( 34), Pyridostatin ( 36), Phen DC3 ( 35) und TrisQ ( 37)). ATP wurde bei t = 0 dem komplementären Strang hinzugefügt (C-mut und C-cmyc) wurde bei t = 45 min zugegeben.

Ähnliche Ergebnisse wurden gefunden, wenn die Serie von G4-Strukturen in Gegenwart dieser G4-Liganden gescreent wurde (Abbildung 7). Wie im ersten Experiment beobachtet, ist das Abwickeln von Schmutz oder S-dx wurde durch die Anwesenheit eines G4-Binders nicht signifikant beeinflusst. Im Gegensatz dazu hemmten alle G4-Liganden das Abwickeln der G4-Substrate. Interessant, TrisQ Hemmung war selektiv: TrisQ blockiert die Enzymaktivität um mehr als 50% auf S-cmyc, S-ckit1, S-ckit2 und S-CEB Substrate, hatte jedoch keinen Einfluss auf das Abwickeln anderer Systeme (S-htelo, S-Kras und S-CTA). S-htelo Es wurde festgestellt, dass das Substrat, das die menschliche Telomersequenz enthält, das System ist, das am wenigsten durch die Zugabe von Liganden beeinflusst wird. S-TBA System zeigte ein interessantes Verhalten. Wie zuvor erwähnt, faltete sich dieses Substrat unter den Assay-gepufferten Bedingungen nicht zu einer Quadruplex-Struktur. Es stellte sich jedoch heraus, dass es in Gegenwart von G4-Liganden ein Hindernis für die Pif1-Helikase darstellt. Dies deutet darauf hin, dass, obwohl die S-TBA Substrat ein stabiles Quadruplex-Motiv enthält, können G4-Liganden als Chaperone wirken, die seine Bildung fördern und daher als Barriere für das Enzym wirken.

Pif1-Helikase-Aktivität gegen DNA-Systeme Schmutz, S-dx, S-cmyc, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S-KRas und S-CTA in Abwesenheit oder Anwesenheit ausgewählter G4-Liganden (Braco-19, Pyridostatin, PhenDC3 und TrisQ). Fehlerbalken zeigen die Standardabweichung von drei unabhängigen Experimenten an.

Pif1-Helikase-Aktivität gegen DNA-Systeme Schmutz, S-dx, S-cmyc, S-htelo, S-ckit1, S-ckit2, S-TBA, S-CEB, S-KRas und S-CTA in Abwesenheit oder Anwesenheit ausgewählter G4-Liganden (Braco-19, Pyridostatin, PhenDC3 und TrisQ). Fehlerbalken zeigen die Standardabweichung von drei unabhängigen Experimenten an.

Insgesamt zeigen diese Ergebnisse, dass die Aktivität von Pif1 durch die Anwesenheit von G4-Bindern gehemmt werden kann und dass diese G4-Liganden echte Inhibitoren der G4-auflösenden Aktivität von Pif1p zu sein scheinen.


DISKUSSION

Wir präsentieren das künstliche Expressionssystem C3P3-G1, das für seine Verwendung in kultivierten Säugerzellen optimiert ist. Nach unserem besten Wissen ist dies das erste künstliche Expressionssystem, das Transkription und Posttranskription erfolgreich koppelt, die Prozesse von außerordentlicher Komplexität in Eukaryoten sind. C3P3-G1 beruht auf einem chimären Single-Unit-Enzym, das aus der Fusion eines mRNA-Capping-Enzyms mit einer DNA-abhängigen RNA-Polymerase besteht. Die RNA-Polymerase-Einheit des C3P3-Enzyms transkribiert in Zellulose spezifische DNA-Matrizen unter der Kontrolle des C3P3-Promotors und synthetisiert RNA-Ketten, die anschließend von der Capping-Enzymeinheit mit einer Kappe versehen werden. Im Gegensatz dazu wird die Polyadenylierung der C3P3-Transkripte durch Transkription einer Polyadenosin-Spur von den DNA-Matrizen synthetisiert. Daher synthetisiert das C3P3-Expressionssystem nach dem Primen autonom RNA-Ketten im Zytoplasma der Wirtszelle und erzeugt die für ihre Translation erforderlichen Schlüsselmodifikationen.

Um das mRNA-Capping von C3P3-G1-Transkripten sicherzustellen, verfolgten wir einen Ansatz, der stark vom Vacciniavirus-T7RNAP-Expressionssystem profitiert hat. Dieser letztere Ansatz verwendet ein rekombinantes Vacciniavirus, das die T7RNAP kodiert, während das Zielgen unter der Kontrolle eines T7-Promotors entweder in ein Plasmid oder ein zweites rekombinantes Vacciniavirus eingebettet ist (28, 29). Da das Vacciniavirus ein intrazellulärer Parasit ist, der sich ausschließlich im Zytoplasma der Wirtszelle repliziert, werden die T7-Transkripte im Zytoplasma der Wirtszelle durch die Vacciniavirus-Enzyme 5'-verkappt und 3'-polyadenyliert (30). Obwohl die durch dieses System hergestellten mRNA-Mengen extrem hoch sind und ~30% der gesamten Steady-State-RNA im Zytoplasma ausmachen, sind nur moderate Mengen von T7-Transkripten richtig 5'-gecappt (30). Eine plausible Erklärung für diese Befunde liefert die überfüllte Umgebung des Zytoplasmas, die ein dichtes Netzwerk von Zytoskelett-Filamenten enthält, wodurch die freie Diffusion großer Makromoleküle wie Proteine, DNA und mRNA behindert wird ( 61). Aufgrund der fehlenden Kopplung zwischen der T7RNAP und dem Vacciniavirus-Capping-Enzym werden die T7-Transkripte schlecht 5'-prozessiert durch das Vacciniavirus-Capping-Enzym. Diese Annahme war zentral für die Entwicklung des C3P3-G1-Enzyms, das vorzugsweise die Fusion zwischen dem Capping-Enzym des Afrikanischen Schweinepestvirus und einer mutierten Bakteriophagen-K1E-RNA-Polymerase ist.

Neben m7 GpppN cap an ihren 5'-Enden enthalten praktisch alle eukaryotischen mRNAs einen Poly(A)-Schwanz, der durch templatunabhängige Addition von Adenosinmonophosphatresten an ihre 3'-terminalen Hydroxylgruppen gebildet wird. Der resultierende 3'-Poly(A)-Schwanz kooperiert synergistisch mit dem 5'-Capping, um die Translation mit supraadditiver Potenzierung zu stimulieren, vermutlich durch Zirkularisieren von mRNA ( 62). Darüber hinaus fördern Poly(A)-Schwänze die Stabilität der Transkripte, während die Deadenylierung ein wichtiger geschwindigkeitsbestimmender Schritt beim mRNA-Zerfall ist ( 63, 64). Im Gegensatz zur nuklearen Polyadenylierung wird der Poly(A)-Schwanz des C3P3-G1 durch die templatabhängige Transkription einer kurzen 40 Adenosinspur vom DNA-Templat erzeugt, gefolgt von einer selbstspaltenden Ribozymsequenz. Die Länge des Poly(A)-Schwanzes der von den Templaten kodierten C3P3-G1-Transkripte ist daher viel kürzer als die von Säugetiertranskripten, die den Kern mit einer einheitlichen Länge von ∼250 Nukleotiden verlassen (65–68). Da die Länge des Poly(A)-Schwanzes stark mit dem Niveau der Genexpression korreliert ( 69), kann die Polyadenylierung aus dem C3P3-G1-Expressionssystem als suboptimal angesehen werden. Weitere Generationen des C3P3-Systems werden den Polyadenylierungsprozess verbessern, möglicherweise durch Anbinden einer Poly(A)-Polymerase an die C3P3-Transkripte.

Eine aktuelle Unvollkommenheit des C3P3-Systems besteht in der unvollständigen Translationseffizienz von C3P3-Transkripten, d. Eine solche unvollständige Translationseffizienz der mRNA könnte durch verschiedene Mechanismen erklärt werden. Erstens könnten die mRNA-Modifikationen der aktuellen Generation des C3P3-Systems unvollständig sein. Unser semiquantitativer Assay (Abbildung 4) legt nahe, dass die Mehrheit der mRNAs von C3P3-G1 überdeckt ist. Nichtsdestotrotz könnten selbst geringe Mengen an nicht verkappter 5'-Triphosphat-RNA eine durch Retinsäure induzierbares Protein I (RIG-I) vermittelte Interferon-α-Antwort und einen Shutdown der Wirtszell-Translation induzieren (70, 71). Die Interferon-α-Antwort kann auch durch das Fehlen von cap-1 an den 5'-Enden von Transkripten induziert werden, das von C3P3-G1 nicht aufgenommen wird (72). Bemerkenswerterweise wurden durch die Polysomen-Profiling-Analyse keine offenen Modifikationen der Ribosomenverteilungsmuster in den Fokus gerückt. Dieser Befund unterstützt nicht die Hypothese einer globalen Hemmung der Wirt-Zell-Translation, wie bei starker Interferon-Antwort erwartet, sondern eine genauere Untersuchung des Gehalts der polysomalen Fraktionen. Die Länge des Polyadenylierungsschwanzes ist auch bekanntermaßen entscheidend für die mRNA-Translation und sollte durch weitere Generationen des C3P3-Systems erhöht werden. Zweitens könnten andere posttranskriptionelle Modifikationen, die nicht von C3P3-G1 durchgeführt werden, für die Translationseffizienz der mRNA kritisch sein. Zum Beispiel das reversible N6,2′-Ö-Dimethyladenosin-Methylierung am ersten kodierten Nukleotid neben der Kappe hat kürzlich festgestellt, dass sie das zelluläre mRNA-Schicksal beeinflusst ( 73). Alternativ könnte das Fehlen anderer Modifikationen das Abschalten der Wirtszell-Translation über den Interferon-Weg oder andere induzieren (70). Beispielsweise können interne Basen Modifikationen wie Pseudouridinierung oder Methylierung an Uridin- oder Cytosinresten unterzogen werden, die die RNA-abhängige Proteinkinase-Aktivierung als Reaktion auf exogene RNA verringern, dann den Translationsinitiationsfaktor 2-α (eIF2-α) phosphorylieren und hemmen Übersetzung ( 74, 75). Drittens könnten Wirtszellproteine, die schließlich auf Prä-Messenger-RNA oder mRNA abgelagert werden, an der Translation teilnehmen. Zum Beispiel trägt der Exon-Junction-Komplex, der im Kernstadium auf Prä-Messenger-RNA aufgebaut wird, sowohl zur Translationseffizienz als auch zum Zerfall der mRNA bei ( 76, 77). Viertens könnten C3P3-Transkripte für ihre Translation durch die Wirtszellmaschinerie unangemessen im zytoplasmatischen Kompartiment positioniert sein. Zum Vergleich: große zytoplasmatisch replizierende DNA-Viren, wie Poxvirus oder Asfarvirus, bilden virale Fabriken, die Transkriptionsfaktoren, Ribosomen und Chaperonine in umschriebene zytoplasmatische Unterkompartimente sequestrieren. Insgesamt werden diese Hypothesen systemisch durch tiefere transkriptionelle und translationale Analysen für weitere Verbesserungen des C3P3-Systems untersucht.

Im Gegensatz zu den standardmäßigen nuklearen Expressionssystemen, die Zugang zur nuklearen Transkriptionsmaschinerie der Wirtszelle benötigen, wurde das C3P3-G1-System als autonomes zytoplasmatisches Expressionssystem entwickelt. Sobald die Expression des C3P3-Enzyms geprimt wurde, wird sie daher unabhängig von der passiven Diffusion der zugeführten DNA durch die Kernporen. Der Durchmesser ihres Hauptkanals, der kleiner ist als der klassische Durchmesser der Plasmid-DNA, erklärt ihre begrenzte Diffusion in den Zellkern und möglicherweise die begrenzte Wirksamkeit der transienten Transfektion (78). Zum Beispiel können nur 1–10% der in kultivierte Zellen transfizierten Plasmide ihre Kerne effektiv erreichen, wie durch quantitative RT-PCR, Southern-Blot-Analyse oder Elektronenmikroskopie bestimmt wurde (79, 80). Daher scheint die zytoplasmatische Prozessivität des C3P3-Systems für die transiente nicht-virale Gentherapie attraktiv zu sein, ein attraktiver Ansatz zur Abgabe therapeutischer Nukleinsäuren für Humantherapeutika ( 81). Die nichtvirale Gentherapie erscheint viel sicherer und weniger immunogen als rekombinante Viren und hat das Potenzial, größere genetische Nutzlasten zu liefern ( 81). Seine Wirksamkeit scheint jedoch relativ begrenzt zu sein, was seine Anwendung stark behindert hat ( 82). Wir gehen daher davon aus, dass das C3P3-System für die nicht-virale Gentherapie verwendet werden kann, insbesondere für Erkrankungen, an denen ruhende Zellen wie Hepatozyten, Skelettmuskelzellen oder naive Immun-B- oder T-Zellen beteiligt sind.

Neben seinen therapeutischen Anwendungen sollte das C3P3-Expressionssystem auch für seine Anwendungen in Betracht gezogen werden in Zellulose. Zum Beispiel kann das C3P3-Expressionssystem auch für transiente Expressionsstudien zum phänotypischen Screening oder anderen verwendet werden.Die künstliche Natur des C3P3-G1-Systems macht es jedoch für die Untersuchung der Transkriptions- oder Translationsregulation von Wirtszellen ungeeignet. Darüber hinaus legen die hohe Leistung des C3P3-G1-Systems in CHO-K1-Zellen und das Fehlen einer nachweisbaren Zelltoxizität des C3P3-Enzyms nahe, dass stabile C3P3-Zelllinien für die Produktion rekombinanter Proteine ​​erzeugt werden könnten.

Eine weitere interessante Anwendung dieses Systems betrifft die RNA-Virusproduktion. Kürzlich Eaton et al. ( 83) haben gezeigt, dass das C3P3-G1-System die Reovirus-Proteinexpression um das 5- bis 10-Fache und die Reovirus-Rettung um das 100-Fache im Vergleich zu dem gegenwärtigen reversen Genetik-System erhöht. Reoviren sind nicht-pathogene Viren, die eine Anti-Tumor-Aktivität zeigen und für die Krebstherapie erforscht werden (84). Diese Ergebnisse sind daher ermutigend, das C3P3-G1-System zur Herstellung von Viren zu verwenden, die 5′-verkappte RNAs enthalten, einschließlich Retroviridae, Rhabdoviridae, Paramyxoviridae, Filoviridae oder Reoviridae.

Zusammenfassend lässt sich sagen, dass das künstliche Expressionssystem C3P3-G1 die wichtigsten mRNA-Modifikationen rekapituliert, die für die mRNA-Translation erforderlich sind, einschließlich RNA-Synthese, Capping und teilweise Polyadenylierung. Dieses System ist für Säugetiere optimiert, kann aber theoretisch an jede andere eukaryontische Spezies angepasst werden. Das C3P3-System sollte als vielseitiges System mit mehreren in Zellulose und in vivo Anwendungen. Wichtig ist, dass das gegenwärtige C3P3-G1-System als fortgeschrittener Prototyp betrachtet werden sollte, dessen Leistungen ohne Zweifel in weiteren Generationen stark verbessert werden.


MATERIALEN UND METHODEN

Chemikalien

[γ- 32 P]ATP (3000 Ci/mmol), [α- 32 P]dTTP (3000 Ci/mmol) und Sephadex G-25 Spin-Säule stammten von Amersham Biosciences, unmarkierte dNTPs stammten von Roche Molecular Biochemicals. Oligonukleotide stammten von Microsynth (Schweiz). Das THF (dSpacer) stammte von Glen Research. Alle anderen Reagenzien waren von analytischer Qualität und wurden von Merck oder Fluka bezogen.

Nukleinsäuresubstrate

Das 100mer Oligonukleotid, das die synthetische (THF) AP-Stelle enthält, sowie der komplementäre Strang und die entsprechenden Primer wurden chemisch synthetisiert und auf denaturierendem Polyacrylamidgel gereinigt. Die Sequenz von 100mer mit THF-Einheit ist wie folgt: 5′ATCCTGATTGCTATCTGAATATGGTGGTGGTGGGCGCCGGCG(X/G)TGTGAATTCGGCACTGGCCGTCATCGTGATCTATCTTACAGTATGCTCTTGGTTGTA3′

In Klammern ist die Position der 43 vom 5'-Ende entfernten Läsion oder des entsprechenden G-Restes in der unbeschädigten Matrize in Fettdruck angegeben (X, THF-Einheit). Dieses doppelsträngige Substrat wurde sowohl für die Einzelenzymassays als auch für das rekonstituierte LP-BER . verwendet in vitro. Alternativ wurden die Enden des Substrats mit Biotin blockiert, indem ein eine THF-Einheit enthaltender Strang an den komplementären Strang angelagert wurde, der Biotin am 3'- bzw. 5'-Ende enthielt. Für den pol-β-Assay enthielt das Substrat eine zusätzliche Lücke von 1 Nukleotid, für den Fen-1-Assay einen 10 nt-Flap (5'-ATCTGATCGC) und für Lig I einen Nick. Die Strukturen dieser Substrate sind in 1B dargestellt.

Proteine ​​und Substrate, die bei der Rekonstitution von Exzisionsreparaturen der langen Pflasterbasis verwendet werden in vitro.(EIN) Rekombinante Proteine ​​wurden wie in „Materialien und Methoden“ beschrieben gereinigt und auf einem 8–20 % Gradienten-SDS-PAGE-Gel aufgetrennt und mit Coomassie Blue gefärbt. Spur 1: Molekulargewichtsmarker Spur 2: APE 1 (2 µg) Spur 3: Pol β (2 µg) Spur 4: Fen 1 (2 µg) Spur 5: Lig I (2 µg) Spur 6: 9-1-1 Komplex (6 μg). (B) Schematische Darstellung der 32 P-5′-markierten Oligonukleotid-Substrate, die in der Studie verwendet wurden: ein 100 bp Duplex-Oligonukleotid mit einer THF-Einheit an Position 43 wurde für Reparaturreaktionen verwendet, die Enden des Substrats waren entweder frei (unblockiertes Substrat) oder blockiert mit einem Biotin an jedem Ende (blockiertes Substrat) ein 100 bp Duplex-Oligonukleotid mit einer 1 Nukleotid Lücke an der gleichen Position wurde für den Pol β Assay mit einem Nick für den Lig I Assay und mit einem 10 Nukleotid Flap für den Fen 1 . verwendet Reaktion

Proteine ​​und Substrate, die bei der Rekonstitution von Exzisionsreparaturen der langen Pflasterbasis verwendet werden in vitro.(EIN) Rekombinante Proteine ​​wurden wie in „Materialien und Methoden“ beschrieben gereinigt und auf einem 8–20 % Gradienten-SDS-PAGE-Gel aufgetrennt und mit Coomassie Blue gefärbt. Spur 1: Molekulargewichtsmarker Spur 2: APE 1 (2 µg) Spur 3: Pol β (2 µg) Spur 4: Fen 1 (2 µg) Spur 5: Lig I (2 µg) Spur 6: 9-1-1 Komplex (6 μg). (B) Schematische Darstellung der 32 P-5′-markierten Oligonukleotid-Substrate, die in der Studie verwendet wurden: ein 100 bp Duplex-Oligonukleotid mit einer THF-Einheit an Position 43 wurde für Reparaturreaktionen verwendet, die Enden des Substrats waren entweder frei (unblockiertes Substrat) oder blockiert mit einem Biotin an jedem Ende (blockiertes Substrat) ein 100 bp Duplex-Oligonukleotid mit einer 1 Nukleotid Lücke an der gleichen Position wurde für den Pol β Assay mit einem Nick für den Lig I Assay und mit einem 10 Nukleotid Flap für den Fen 1 . verwendet Reaktion

Proteine ​​und Antikörper

Humane AP-Endonuklease 1 wurde von Enzymax LLC bezogen. Rinderserumalbumin (BSA) wurde von New England BioLabs bezogen. Der 9-1-1-Komplex wurde isoliert, indem in Sf21-Zellen die drei Baculoviren, die das rekombinante hRad1, his-hRad9 und hHus1 kodieren, co-exprimiert wurden. Der Komplex wurde anschließend wie zuvor beschrieben gereinigt (39). Humanes PCNA wurde hergestellt in Escherichia coli unter Verwendung des Plasmids pT7/hPCNA und wie beschrieben bis zur Homogenität gereinigt (46). Humanes rekombinantes Pol β, Fen 1 und Lig I wurden in exprimiert E coli und gereinigt wie zuvor beschrieben ( 47–49). Die Anti-Hus1- und Anti-Rad9-Antikörper, die in Toueille et al. ( 39) waren ein Geschenk von R. Freire (Teneriffa, Spanien). Der Ziegen-Anti-Rad1-Antikörper (N18) sowie der Kaninchen-Anti-APE 1 (Anti-Ref1, H300)-Antikörper stammten von Santa Cruz Biotechnology.

Enzymatische Assays

AFFE 1 Inzisionsassay. Ein 100 bp Duplex-Oligonukleotid-Substrat wurde wie folgt hergestellt: Ein 100-mer Oligonukleotid, das eine THF-Einheit an der Position 43 enthielt, wurde an den komplementären Strang angelagert ( 1B ). Vor dem Annealing wurde ein eine Läsion enthaltender Strang am 5'-Ende mit T4-Polynukleotidkinase und [γ- 32 P]ATP markiert. Nicht eingebaute markierte Nukleotide wurden auf einer Sephadex G-25-Spin-Säule entfernt. APE 1-Schnittreaktionen wurden in einem Reaktionsgemisch (10 µl) mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . durchgeführt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol Oligonukleotid-Substrat und die angegebenen Mengen an APE 1. Die Enden des Oligonukleotid-Substrats waren entweder frei oder mit Biotin blockiert, wie in der angegeben Abbildung Legenden. Die Reaktionen wurden 20 min bei 37 °C inkubiert und durch Zugabe eines gleichen Volumens Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylencyanol) gestoppt. Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die Wirkung des 9-1-1-Komplexes auf die Aktivität von APE 1 zu bestimmen, wurden die Reaktionen wie oben beschrieben durchgeführt, mit der Ausnahme, dass konstante Mengen von APE 1 in der Reaktionsmischung enthalten waren und eine steigende Menge von 9-1-1 Komplex wurden wie in Fig. 4A angegeben zugegeben.

Pol β Assay

Ein 42-mer-Oligonukleotid wurde am 5'-Ende radioaktiv markiert und mit einem stromabwärts gelegenen 57-mer-Oligonukleotid an den komplementären 100-mer-Strang angelagert. Das resultierende 32 P-markierte Duplex-Oligonukleotid hat eine 1-nt-Lücke an der Position 43 ( 1B ). Die Pol-β-DNA-Synthese wurde durch Messen der Nukleotid-Insertion in das oben beschriebene DNA-Substrat bestimmt. Die Reaktionen wurden in einem Endvolumen von 10 µl mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . durchgeführt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 &mgr;M dATP, dCTP, dGTP, dTTP, 50 fmol Oligonukleotid-Substrat mit Lücke und die angegebenen Mengen an Pol β. Die Reaktionen wurden 20 min bei 37 °C inkubiert und durch Zugabe eines gleichen Volumens Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylencyanol) gestoppt. Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht.

Pol β Aktivitätsassay auf dem läsionshaltigen Substrat

Die Pol-β-Aktivität auf dem 32 P-5'-markierten Duplex-Oligonukleotid-Substrat, das die THF-Einheit an Position 43 enthielt, wurde in Gegenwart einer konstanten Menge von APE 1 getestet. Die Reaktionen wurden 20 min bei 37 °C im Reaktionspuffer inkubiert (10 μl), das 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl . enthielt2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 μM dATP, dCTP, dGTP, dTTP, 50 fmol THF-haltiges Oligonukleotidsubstrat, 55,5 fmol APE 1 und die angegebenen Mengen an Pol β. Nach der Inkubation wurden die Reaktionen durch Zugabe eines gleichen Volumens Gelladepuffer (95 % Formamid, 20 mM EDTA, 0,02 % Bromphenolblau und 0,02 % Xylolcyanol) gestoppt, 5 min auf 100 °C erhitzt und die Produkte getrennt durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel und visualisiert durch Autoradiographie.

Fen 1 Endonuklease-Assay

Der Fen 1-Assay wurde wie beschrieben mit einigen Modifikationen durchgeführt ( 42). Um ein Flap-Substrat herzustellen, wurden 42- und 68-mer-Oligonukleotide an den komplementären 100-mer-Strang angelagert. Vor dem Annealing wurde ein 68-mer-Oligonukleotid am 3'-Ende mit terminaler Desoxynukleotidyltransferase und [α- 32 P]ddATP radioaktiv markiert. Ein so hergestelltes 32 P-markiertes Duplex-Oligonukleotid hatte einen 10-nt-Flap an der Position 43 ( 1B ). Der Fen 1-Spaltungsassay wurde in der Reaktionsmischung (10 µl) mit 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl&sub2;2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol Flap-Oligonukleotid-Substrat und die angegebenen Mengen an Fen 1. Die Reaktionen wurden bei 37 °C für 20 min inkubiert und durch Zugabe eines gleichen gestoppt Volumen Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylolcyanol). Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die stimulierende Wirkung des 9-1-1-Komplexes auf die Fen 1-Endonukleaseaktivität zu messen, wurden die Reaktionen unter den gleichen Bedingungen durchgeführt, außer dass konstante Mengen an Fen 1 im Reaktionspuffer vorhanden waren (25 fmol) und die angegebenen Mengen des 9-1-1-Komplexes wurden hinzugefügt, wie in 8C gezeigt.

Lig I Assay

Der Lig I-Assay wurde wie beschrieben mit Modifikationen (40) unter Verwendung von 42-mer- und 32 P-5'-markierten 58-mer-Oligonukleotiden durchgeführt, die an den komplementären 100-mer-Strang angelagert waren. Reaktionsmischungen (10 μl) enthielten 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, 50 fmol eines abgespaltenen Oligonukleotid-Substrats und die angegebenen Mengen Lig I. Die Reaktionen wurden bei 37 °C für 20 min inkubiert und durch Zugabe von &dgr; gleiches Volumen Gelladepuffer (95% Formamid, 20 mM EDTA, 0,02% Bromphenolblau und 0,02% Xylolcyanol). Nach einer Inkubation bei 100°C für 5 min wurden die Reaktionsprodukte durch Elektrophorese auf einem 10 % denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht. Um die stimulierende Wirkung des 9-1-1-Komplexes auf die Lig I-Aktivität zu messen, wurden die Reaktionen unter den gleichen Bedingungen durchgeführt, außer dass konstante Mengen Lig I im Reaktionspuffer vorhanden waren (0,5 fmol) und die angegebenen Mengen an 9- 1-1-Komplex wurde zugegeben, wie in Fig. 8D angegeben.

Rekonstituiertes in vitro LP-BER

Der LP-BER-Assay wurde wie zuvor beschrieben mit Modifikationen (14, 50) durchgeführt. Die kompletten Reparaturreaktionen wurden im Reaktionspuffer (10 µl) durchgeführt, der enthielt: 45 mM Hepes/KOH (pH 7,8), 70 mM KCl, 7,5 mM MgCl2, 2 mM Dithiothreitol, 0,5 mM EDTA, 0,1 mg/ml BSA, 2 mM ATP, jeweils 20 μM dATP, dCTP, dGTP, dTTP und 50 fmol 32 P-5′-markiertes 100 bp Duplex-Oligonukleotidsubstrat mit einem THF an der Position 43. Die Enden des Oligonukleotidsubstrats waren entweder frei oder mit Biotin blockiert, wie in den Legenden der Figuren angegeben. Für die Rekonstitution von LP-BER unter Verwendung von unmarkiertem Substrat wurden die gleichen Bedingungen verwendet, mit der Ausnahme, dass die Konzentration von dTTP auf 8 μM reduziert wurde und [α- 32 P] dTTP (2.5 μCi) zu den Reaktionsmischungen zugegeben wurde. Die Reaktionen wurden durch die Zugabe von gereinigtem APE 1 (55 fmol), Pol β (64 fmol), Fen 1 (93 fmol) und Lig I (245 fmol) initiiert. Dem rekonstituierten LP-BER . wurden zunehmende Mengen des 9-1-1-Komplexes zugesetzt in vitro Reaktion unter Grenzbedingungen für jedes der vier Enzyme APE 1, Pol β, Fen 1 und Lig I (siehe „Ergebnisse“). Nach 20-minütiger Inkubation bei 37 °C wurden die Reaktionen durch Zugabe eines gleichen Volumens Gelladepuffer (95 % Formamid, 20 mM EDTA, 0,02 % Bromphenolblau und 0,02 % Xylolcyanol), erhitzt auf 100 °C, gestoppt 5 min, und die Endprodukte wurden durch Elektrophorese auf einem 10% denaturierenden Polyacrylamidgel aufgetrennt und durch Autoradiographie sichtbar gemacht.

Pulldown-Assays

Für die His-Pulldowns wurden 6 µg des his-tagged 9-1-1 Komplexes bzw. der his-tagged Untereinheiten Rad9, Rad1 oder Hus1 mit 1 µg APE 1 für 2 h bei 4°C in Pulldown-Puffer [50 mM Tris-HCl (pH 8,0), 100 mM NaCl, 0,05% (v/v) NP-40]. Ni 2+ -Kügelchen, die zuvor durch Inkubation über Nacht in Pulldown-Puffer mit 5 mg/ml BSA beschichtet worden waren, gefolgt von drei Waschungen in Pulldown-Puffer, wurden dann zu den Proteinen gegeben. Anschließend wurden die Proben 1 h bei 4°C inkubiert. Nach fünfmaligem Waschen in Pulldown-Puffer mit 5 mM Imidazol wurden die Beads 5 min bei 95 °C in Laemmli-Puffer erhitzt und die co-präzipitierten Proteine ​​mittels Western-Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.

Für die APE-1-Sepharose-Pulldowns wurde gereinigtes APE 1 oder BSA, das als Negativkontrolle verwendet wurde, kovalent an CNBr-aktivierte Sepharose (Amersham Pharmacia Biotech) wie vom Lieferanten beschrieben in einem Endverhältnis von 1 μg Protein/μl . gekoppelt von Perlen. APE-1-Sepharose oder BSA-Sepharose (10 µl) wurden anschließend einmal in Pulldown-Puffer mit 10 mg/ml BSA und dreimal in Pulldown-Puffer gewaschen. Die Kügelchen wurden anschließend mit 300 ng his9-1-1-Komplex für 2 h in Pulldown-Puffer bei 4°C inkubiert. Nach fünfmaligem Waschen in Pulldown-Puffer wurden die Beads 5 min bei 95 °C in Laemmli-Puffer erhitzt und die copräzipitierten Proteine ​​mittels Western Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.

Ganzzellextrakte

Zur Herstellung von Gesamtzellextrakten wurden 7 × 10 6 293T-Zellen durch Trypsinierung gefolgt von Zentrifugation geerntet. Das Zellpellet wurde anschließend in Zelllysepuffer [50 mM Hepes-KOH, pH 7,5, 400 mM NaCl, 1 mM DTT, 2,5 mM MgCl&sub2;2, 20 % Glycerin, 0,5 % (v/v) NP40, 2 µg/ml Leupetpin, 1 µg/ml Bestatin, 1 µg/ml Pepstatin, 2 mM PMSF, 10 mM Glycerophosphat, 1 mM NaF, 10 mM Na4P2Ö7] für 15 min bei 4°C. Anschließend wurde das Zelllysat 15 min bei 10000 rpm zentrifugiert, der Überstand gesammelt und als Gesamtzellextrakt aufbewahrt. Die Proteinkonzentration wurde unter Verwendung des Bradford-Assays bestimmt.

Immunpräzipitationen

Für Immunpräzipitationen wurden 25 µl Protein G-Sepharose 3 Stunden bei 4 °C mit 100 µg BSA in IP-Puffer (40 mM Hepes-KOH, pH 7,5, 100 mM NaCl, 8 mM MgCl .) beschichtet2, 2 µg/ml Leupetpin, 1 µg/ml Bestatin, 1 µg/ml Pepstatin, 2 mM PMSF, 10 mM Glycerophosphat, 1 mM NaF, 10 mM Na4P2Ö7) und anschließend über Nacht mit 3 µg anti-Rad9-Antikörper oder dem unimmunisierten Kaninchen-IgG inkubiert. Nach dreimaligem Waschen in IP-Puffer wurden die Kügelchen mit 1 mg 293 T Gesamtzellextrakt für 3 h bei 4°C inkubiert. Nach der Inkubation wurden die Kügelchen dreimal in IP-Puffer, der 0,05% NP40 enthielt, gewaschen und anschließend für 5 Minuten bei 95 °C in Laemmli-Puffer erhitzt. Die copräzipitierten Proteine ​​wurden mittels Western Blot mit den entsprechenden Antikörpern nach etablierten Methoden analysiert.


ERGEBNISSE

Eine AP-Stelle in einer einzelsträngigen 7-nt-Schleife wird von Hefe-AP-Endonukleasen schlecht erkannt

Wir und andere haben gezeigt, dass ssOligos mit einer einzigartigen Läsion verwendet werden können, um Läsionsbypass bei Hefe zu untersuchen [21, 22]. Die lys2� Allel ist ein 𢄡 Frameshift-Allel und hat sich als besonders nützlich für die Untersuchung von Läsionsbypass erwiesen [21, 22]. Ein einzigartiges Merkmal der lys2� Allel besteht darin, dass eine kompensatorische +1-Rahmenverschiebung überall innerhalb eines ungefähr 150 bp großen ȁKreversionsfensters” auftreten kann und daher transformierende ssOligos das korrigierende Nukleotid oder die korrigierende Läsion überall innerhalb dieses Fensters haben können[21, 22, 27]. zusätzlich lys2� Das Reversionsfenster kann eine signifikante Anzahl von Nukleotidinsertionen in Schritten von 3n+1 (n = 0,1,2,3. ) akzeptieren. Dies wurde durch unsere jüngste Arbeit demonstriert, die zeigt, dass Hefe effektiv mit ssOligos transformiert werden kann, die an chromosomale DNA anlagern, um entweder eine 1-nt- oder 7-nt-Schleife zu erzeugen[22]. Diese beiden Besonderheiten machen die lys2� Allel sehr attraktiv für das Studium von Mechanismen der Mutagenese, insbesondere im Hinblick auf die Wirkung des Sequenzkontexts auf den mutagenen Läsionsbypass.

Die meisten DNA-Reparaturenzyme, einschließlich APN1, können DNA-Schäden nur dann effizient erkennen, wenn die Läsion im Zusammenhang mit doppelsträngiger DNA steht. Unsere frühere Studie zeigte, dass bei der Transformation von Hefe mit einem ssOligo, das eine 1-nt-Schleife mit einer AP-Stelle erzeugt, eine effiziente Transformation nur in Hefe beobachtet wurde apn1 Mutanten, denen die Haupt-AP-Endonuklease APN1 fehlt[21]. Diese Daten legten nahe, dass Hefe-APN1 immer noch eine AP-Stelle erkennen kann, wenn sich die Läsion in einer 1-nt-Schleife befindet. Es wird jedoch erwartet, dass APN1 die AP-Läsion nicht mehr erkennt, wenn sich die AP-Stelle in einer größeren einzelsträngigen Schleife befindet.Um dies zu bestätigen, wurde ein ssOligo, das anlagert, um eine einzelsträngige 7-nt-Schleife zu erzeugen, die eine zentral gelegene AP-Stelle enthält, auf seine Substratempfindlichkeit mit gereinigtem Hefe-APN1 untersucht ( 1 ). Duplex D-U4 und Heteroduplex D-(+7)U4 wurden durch Hybridisieren des Oligonukleotids COD(+7)-U4 an CS bzw. CS-7 hergestellt. Duplex D-S4 und Heteroduplex D-(+7)S4, die eine AP-Stelle in perfektem Duplex bzw. in einer 7-nt-Schleife enthalten, wurden dann durch Inkubation von Duplex D-U4 und Heteroduplex D-(+7)U4 . hergestellt mit einer überschüssigen Menge an Uracil-DNA-Glycosylase. Duplex D-S4 und Heteroduplex D-(+7)S4 wurden dann mit verschiedenen Konzentrationen von Hefe APN1 behandelt. Abbildung 1 zeigt, dass APN1 die AP-Läsion effizient erkennt, wenn sie sich in einer perfekten Duplex-DNA befindet (Bahnen 3𢄦), jedoch konnte APN1 die AP-Stelle nicht erkennen, wenn sich die AP-Stelle in einer 7-nt-Schleife befand (Bahnen 7�) . Ein merkliches Nicking des Duplex D-S4 wurde bei 6 ng APN1 beobachtet ( 1 , Spur 4), und mehr als 90% Nicking des Duplex D-S4 wurde bei APN1-Konzentrationen von mehr als 30 ng beobachtet ( 2 , Bahn 6). Im Gegensatz dazu wurde unter den gleichen Reaktionsbedingungen selbst bei 150 ng APN1 kein nennenswertes Nicking von Heteroduplex D-(+7)S4 beobachtet ( 1 , Spur 10). Wenn ssOligo COD(+7)-S4 an das Genom anlagert lys2ΔA746 Allel des Wildtyps APN1 Hefe (SJR922) wird eine identische 7-nt-Schleife erzeugt, die eine zentral gelegene AP-Stelle enthält (siehe 1 , Ergänzende Daten). Es wird erwartet, dass die AP-Stelle in der 7-nt-Schleife refraktär gegenüber der zellulären APN1-Aktivität ist, und daher wird erwartet, dass man die Umgehung einer AP-Stelle in reparaturfähigen Wildtyp-Hefe untersuchen kann. Um dies zu demonstrieren, verglichen wir die Anzahl von Transformanten, die durch Transformieren verschiedener reparaturdefizienter Mutantenstämme mit 300 pMol COD(+7)-S4 erhalten wurden. Wir haben früher gezeigt, dass 300 pmol ssOligo optimal sind und innerhalb des linearen Transformationsbereichs liegen [21, 22]. Tabelle I zeigt, dass die durchschnittliche Anzahl der erhaltenen Transformanten für alle getesteten Stämme ähnlich war, einschließlich der Wildtyp-Hefe SJR922, SJR1777 (apn1Δ), SJR1780 (apn1Δ apn2Δ) und SJR2367 (apn1Δ ogg). Diese Daten legen nahe, dass weder APN1 noch andere DNA-Reparaturenzyme wie APN2 und OGG1 in der Lage sind, die Reparatur einer AP-Stelle einzuleiten, wenn sich die Läsion in der Mitte einer 7-nt-Schleife befindet.

Duplex-Substrate (D-S1, D-S2, D-S3, D-S5, D-S6 und D-S7) und Heteroduplex-Substrate mit einer 7-nt-Schleife [D(+7)-S1, D(+7 .) )-S2, D(+7)-S3, D(+7)-S5, D(+7)-S6 und D(+7)-S7] wurden wie in experimentellen Verfahren beschrieben hergestellt. Fünfzig fmol Duplex- und Heteroduplex-Substrate, die eine AP-Stelle enthielten, wurden mit unterschiedlichen Mengen an Hefe-APN1 bei 37ଌ für 15 Minuten behandelt. Tafel S1: Substrate konstruiert mit Oligonukleotid COD(+7)-S1 Tafel S2: Substrate konstruiert mit Oligonukleotid COD(+7)-S2 Tafel S3: Substrate konstruiert mit Oligonukleotid COD(+7)-S3 Tafel S5: Substrate konstruiert mit Oligonukleotid COD (+7)-S5 Tafel S6: Substrate konstruiert mit Oligonukleotid COD(+7)-S6 Tafel S7: Substrate konstruiert mit Oligonukleotid COD(+7)-S7.

Tabelle I

Anzahl der unter Verwendung von COD(+7)-S4 erhaltenen Transformanten am Lys2� Allel.

Relevanter GenotypExp#1Exp#2Exp#3Durchschnitt
WT1150222817661715 ± 540
㥊pn1994233011001474 ± 742
㥊pn1 㥊pn21116212624481897 ± 695
㥊pn1 Δogg11104216225441924 ± 741

Hintergrundreversionen für jeden dieser Stämme lagen im Bereich von 40� Kolonien, mit oder ohne 300 Picomol Kontroll-Oligonukleotid COD-AR.

Die Aktivität von APN1 auf einer AP-Site kann variieren, je nachdem, ob sich die AP-Site an der Basis 5’ oder an der Basis 3’ der Schleife befindet. Um zu bestimmen, ob die Position einer AP-Stelle innerhalb einer 7-nt-Schleife die APN1-Aktivität beeinflusst, wurden 7-nt-Schleifensubstrate, die eine AP-Stelle an verschiedenen Positionen innerhalb der Schleife enthielten, mit APN1 behandelt. Abbildung 2 zeigt, dass, wenn sich eine AP-Stelle an den Positionen S2 bis S7 (siehe Abbildung 1, Ergänzende Daten) in der 7-nt-Schleife befindet, selbst bei 75 ng APN1 kein nennenswertes Nicking der Heteroduplex-Substrate durch APN1 beobachtet wurde (Abbildung 2 .). , Tafeln S2 bis S7). Befindet sich jedoch eine AP-Stelle an der Position 5’ der Schleife (S1-Position, Abbildung 1, Ergänzende Daten), wurde eine signifikante Spaltung des Substrats bei hohen APN1-Konzentrationen beobachtet (Abbildung 2, Tafel S1). Bei 30 ng und 75 ng APN1 wurden 13% und 78% der 7-nt-Schleifensubstrate gespalten ( 2 , Tafel S1, Bahnen 2 und 3). Im Gegensatz dazu wurden bei 6 ng APN1 mehr als 95 % des Duplexsubstrats gespalten ( 2 , Tafel S1, Spur 4). Diese Daten legen nahe, dass dieses System im Allgemeinen geeignet ist, um die Umgehung einer AP-Stelle in reparaturfähigen Wildtyp-Hefezellen zu untersuchen. Wenn sich eine AP-Stelle an der Basis 5’ der 7-nt-Schleife (S1-Position, Abbildung 1 , Ergänzende Daten) befindet, wird jedoch aufgrund der möglichen Reparatur durch zelluläre APN1-Aktivität eine verringerte Transformationseffizienz erwartet. Dies wird in Abbildung 3 deutlich gezeigt. Abbildung 3 zeigt, dass die durchschnittliche Anzahl der erhaltenen Transformanten mit allen COD-Oligonukleotiden [COD(+7)-S2 bis COD(+7)-S7], mit Ausnahme von COD(+7)-S1, für beide Wild- Typ und apn1 Hefe. Zum Beispiel WT und apn1 Hefe, die mit 300 pMol COD(+7)-S7 transformiert wurde, ergab 1144 bzw. 1374 Lys+-Transformanten. Im Gegensatz dazu WT und apn1 Hefe, die mit 300 pMol COD(+7)-S1 transformiert wurde, ergab 709 bzw. 1450 Lys+-Transformanten. Dies stimmt mit der Beobachtung überein, dass APN1 die Läsion der AP-Stelle immer noch spalten kann, wenn sich eine AP-Stelle an der Basis 5’ der 7-nt-Schleife (S1-Position, Abbildung 1 , Ergänzende Daten) befindet, wodurch eine niedrigere Anzahl von Transformanten für die Wildtyp-Hefe.

Sowohl WT als auch apn1 Mutantenhefe wurden mit 300 pMol COD-Oligonukleotiden transformiert. Die Anzahl der erhaltenen Transformanten wurde gegen die Position der AP-Stelle innerhalb der 7-nt-Schleife aufgetragen. Alle Daten stellen den Durchschnitt von zwei unabhängigen Transformationen dar, und der aufgetragene Fehlerbalken ist die Standardabweichung der Stichprobe.

Validierung des 7-nt-Loop-Systems zur Untersuchung des Läsionsbypasses in Wildtyphefe

Das obige Experiment zeigt deutlich, dass COD-ssOligos, die eine AP-Stelle enthalten, verwendet werden können, um die Umgehung der AP-Stelle in reparaturfähigen Hefen zu untersuchen. Um zu validieren, dass ssOligos, das eine a7-nt-Schleife enthält, für die Untersuchung des Läsions-Bypass geeignet ist, werden wir die Rolle verschiedener DNA-Läsions-Bypass-Polymerasen beim Bypass einer AP-Stelle bestimmen. Die Transformation wurde unter Verwendung von ssOligos COD(+7)-S4 und COD(+7)-F4 mit einer einzigartigen AP-Stelle bzw. Tetrahydrofuran, einem Analogon der AP-Stelle, durchgeführt. Elektrokompetente Wildtyp-Hefe (SJR922) wurde mit einer Mischung transformiert, die 300 pMol ssOligo und 5 ng pSR313-Plasmid enthielt, a HIS3-enthaltend CEN Plasmid. Das Verhältnis von Lys + /His + -Kolonien wurde verwendet, um die Transformationseffizienz eines Kontroll-ssOligo [COD(+7)-A4] mit der von ssOligos mit einer AP-Stelle oder Tetrahydrofuran [COD(+7)-S4 und COD (+7)-F4] und wurde verwendet, um die Effizienz der Umgehung der AP-Stelle zu berechnen (Tabelle II). Tabelle II zeigt, dass sowohl eine AP-Stelle als auch ein THF mit relativ hohen Wirkungsgraden von 65% bzw. 59% umgangen wurden. Die beobachteten Bypasseffizienzen waren signifikant höher als die von uns und anderen zuvor berichteten [14-16, 19-21] . In früheren Ergebnissen mit ssOligos, die eine +1 nt-Schleife mit einer AP-Stelle erzeugen, wurde beobachtet, dass die Bypass-Effizienz im Wildtyp für beide weniger als 10 % betrug lys2�[21] und cyc1𢄡 Allele[20].

Tabelle II

Bypass-Effizienz einer AP-Stelle und THF in reparaturfähiger Hefe.

Kontroll-DNA COD(+7)-A4AP DNA COD(+7)-S4THF DNA COD(+7)-F4
Erw. # 1Erw. # 2Erw. # 1Erw. # 2Erw. # 1Erw. # 2
pRS313a (P)288002064017600207203056020880
ssOligo b (L)308023401260144016401574
L/P0.1070.1130.0720.0700.0540.075
Durchschnitt (L/P)0.11ଐ.00420.071ଐ.00140.065ଐ.0148
Bypass-Wirkungsgrad c 10.650.59

Wir und andere haben gezeigt, dass die Umgehung einer AP-Stelle die aktive Beteiligung von REV1 und Pol ζ (REV3/REV7) erfordert, aber nicht RAD30 Polymerase η) [14-16, 20, 21]. Um zu zeigen, dass die Umgehung einer AP-Stelle in Wildtyp-Hefe auch primär von den REV1- und REV3-Proteinen abhängt, wurden Hefemutanten, denen die REV1, REV3 oder RAD30 Gen wurden mit COD(+7)-S4 und COD(+7)-F4 transformiert. Abbildung 4 zeigt, dass bei Verwendung von COD(+7)-S4 zur Transformation von Hefe die Bypass-Effizienz für die AP-Stelle in signifikant abnahm rev1Δ(7,4%) und rev3Δ (2,7%) Mutanten und war nicht betroffen in rad30Δ Mutante (88 %). Kleinere Abnahmen der Bypass-Effizienz für THF wurden für beobachtet rev1Δ, rev3Δ und rad30Δ Mutanten (21 %, 11 % bzw. 55 %). Diese Daten stimmen mit früheren Beobachtungen überein, die die Effizienz von THF in beiden Fällen umgehen rev1Δ und rev3Δ Mutanten waren signifikant höher als die Bypass-Effizienz für eine AP-Stelle, was darauf hindeutet, dass ein signifikanter Anteil des Bypasses an einem THF-Rest durch andere Polymerasen als REV1 und REV3 vermittelt wird[20, 21]. Es ist wahrscheinlich, dass zumindest ein Teil des Rest-THF-Bypass auf Polη zurückzuführen ist.

Das einzelsträngige Oligonukleotid COD(+7)-S4 wurde verwendet, um Wildtyp-, rev1Δ, rev3Δ, und rad30Δ Stämme. Die Bypass-Wirksamkeiten von AP-Stellen und THF wurden wie in Tabelle II beschrieben bestimmt.

Um die Rolle von REV1 und Polζ in Polη, dem Bypass und einer durch COD(+7)-S4 erzeugten AP-Stelle weiter zu untersuchen, wurden Transformanten sequenziert und die Mutationsspezifität wurde für jeden der Hefestämme erhalten (Tabelle III ). Wie erwartet, waren dC (68%) gefolgt von dA (32%) die Hauptnukleotide, die gegenüber einer AP-Stelle in Wildtyp-Hefe inseriert wurden (Tabelle III). Löschung von REV1 oder REV3 Gen führte zu einer Reduktion von dC und einer erhöhten Häufigkeit des Einbaus von dA gegenüber einer AP-Stelle (die Insertion von dA im Wildtyp beträgt 31 % im Vergleich zu 64 % und 82 % bei Δrev1 und Δrev3, bzw). Das umgekehrte Muster zeigte sich im Polη-defekt rad30 Mutante, wobei der dC-Einbau auf 81% zunimmt und der dA-Einbau auf 19% abnimmt. Dies stimmt mit der Interpretation überein, dass Polη eine untergeordnete Rolle bei der Insertion von dA gegenüber einer AP-Stelle spielt.

Tabelle III

Bypass-Spezifität einer durch COD(+7)-S4 erzeugten AP-Stelle in reparaturfähiger Hefe.

Hefestamm% Nukleotid, eingefügt über die AP-Stelle (kein a)
dAdGdCdT
Wildtyp32.0 (8)-68.0 (17)-
Δrad3019.1 (4)-80.9 (17)-
Δrev163.6 (14)9.1 (2)18.2 (4)9.1 (2)
Δrev381.8 (18)13.6 (3)4.5 (1)-

Auswirkung des Sequenzkontexts auf die Umgehung der AP-Site

Um die Wirkung des Sequenzkontexts auf die Umgehung einer AP-Stelle zu untersuchen, wurden ssOligos, die AP-Stellen enthielten, die in einen anderen Sequenzkontext eingebettet waren, für den Transformationsassay verwendet ( 1 , Ergänzende Daten). Die COD- und NC-Reihe von Oligonukleotiden sind ssOligos, die dieselbe Sequenz wie die kodierenden und nicht-kodierenden Stränge der LYS2 Gen bzw. Im Zusammenhang mit der Chromosomenreplikation LYS2 Das Gen wird hauptsächlich von einem stromaufwärts gelegenen Ursprung repliziert, wodurch die kodierenden und nicht-kodierenden Stränge die nacheilenden bzw. führenden Replikationsstränge sind[31]. Tabelle IV zeigt, dass die Bypass-Wirksamkeiten von AP-Stellen, die in Experimenten unter Verwendung der acht COD-ssOligos beobachtet wurden, von 7% bis zu 74% reichten. Wenn Hefetransformationen mit den NC ssOligos durchgeführt wurden, variierten auch die Bypass-Wirksamkeiten für AP-Stellen stark und lagen in Abhängigkeit von der Position der AP-Stelle innerhalb der 7-nt-Schleife zwischen 8% und 35%. Diese Daten unterstützen eindeutig die Vorstellung, dass die Bypass-Effizienz einer AP-Stelle signifikant durch den die Läsion umgebenden Sequenzkontext beeinflusst wird. Um die Wirkung des Sequenzkontexts auf die Umgehung der AP-Stelle weiter zu bestätigen, haben wir die Umgehungseffizienzen von zwei ssOligos verglichen, die eine AP-Stelle an derselben Position in der Schleife, aber mit unterschiedlichem Sequenzkontext haben. Tabelle IV zeigte, dass die Bypass-Effizienz einer AP-Stelle, die bei COD(+7)-S4’ beobachtet wurde, signifikant niedriger war als bei COD(+7)-S4 (16 % gegenüber 74 %), was die Annahme stützt, dass der Sequenzkontext um eine AP Site kann die Bypass-Effizienz einer AP-Site beeinflussen. Es besteht jedoch die Möglichkeit, dass AP-Stellen am oder in der Nähe des Bodens der Schleife von APN1 erkannt werden, was zu einer offensichtlich geringeren Effizienz des Bypasses führt. Wie bereits erwähnt, beobachteten wir nur dann eine signifikante Erkennung durch APN1, wenn sich eine AP-Stelle an der Basis 5’ der Schleife befand (Abbildung 2, Panel S1), und dies könnte die geringere Effizienz des AP-Bypasses erklären, die an der 5’ beobachtet wurde. x02019 Basis der Schleife [COD(+7)-S1 und NS(+7)-S7 ssOligos, Tabelle IV ] im Vergleich zur 3’ Basis der Schleife [COD(+7)-S7 und NC(+7 .) )-S1 ssOligos, Tabelle IV].

Tabelle IV

Wirkung des Sequenzkontexts auf die Bypass-Effizienz der AP-Stelle in Wildtyp-Hefe.

Oligonukleotide lagern sich an den Bypass der AP-Stelle des führenden Strangs auf dem nacheilenden Strang an.% Bypass a (WT)Oligonukleotide lagern sich an den Bypass der AP-Stelle des nacheilenden Strangs am führenden Strang an.% Bypass b (WT)% Bypass b (rev1Δ)% Bypass b (rev3Δ)% Bypass b (rad30Δ)
COD(+7)-S17.3 ± 4.4Öffner(+7)-S111,5 ± 7,21,1 ± 0,40,8 ± 0,715.1 ± 4.3
COD(+7)-S224,5 ± 2,3Öffner(+7)-S222,0 ± 12,61,8 ± 0,10,8 ± 0,518,9 ± 6,0
COD(+7)-S344,6 ± 18,3Öffner(+7)-S321,7 ± 10,72,0 ± 0,51,5 ± 0,534,7 ± 13,1
COD(+7)-S473,5 ± 11,4Öffner(+7)-S434,9 ± 3,911,4 ± 4,38,0 ± 5,936,5 ± 0,7
COD(+7)-S418,3 ± 5,4 c --------------------
COD(+7)-S530,0 ± 6,2Öffner(+7)-S518,4 ± 0,47,5 ± 1,11,9 ± 0,528,8 ± 6,7
COD(+7)-S633,0 ± 6,1Öffner(+7)-S614,5 ± 1,31,2 ± 1,00,6 ± 0,113,1 ± 3,7
COD(+7)-S714,6 ± 3,3Öffner(+7)-S77,8 ± 1,01,1 ± 0,20,7 ± 0,36.4 ± 2.9

Um die Wirkung des Sequenzkontexts auf REV1-, Polζ- und Polη-Aktivitäten zu bestimmen, wurden ssOligo-vermittelte Transformationen in durchgeführt rev1Δ, rev3Δ und rad30Δ Mutanten (Tabelle IV Tabelle I in den ergänzenden Daten zeigt die tatsächlichen Bypass-Daten der zwei unabhängigen Transformationen, die für diese Mutantenstämme durchgeführt wurden). Wie erwartet, waren in Abwesenheit des REV1- oder REV3-Proteins die Bypass-Wirksamkeiten für AP-Stellen stark auf einen Bereich von 1 % bis 11 % verringert (Tabelle IV). Die Bypass-Effizienz für einen AP-Standort war in den Jahren durchweg niedriger rev3Δ als in der rev1Δ Mutante, was darauf hindeutet, dass der Bypass nicht vollständig von REV1 abhängig ist. Wie in Tabelle IV angegeben, waren die Bypass-Wirksamkeiten in Abwesenheit von REV1 oder REV3 in ähnlicher Weise wie bei der Wildtyp-Hefe auch vom Sequenzkontext abhängig. In Abwesenheit von REV1 oder REV3 wird die Umgehung einer AP-Stelle möglicherweise von Pol α/δ[16] durchgeführt, was darauf hindeutet, dass die Umgehung einer AP-Stelle durch Pol α/δ ähnlich beeinflusst werden kann durch den Sequenzkontext. Wie erwartet spielte RAD30 nur eine untergeordnete Rolle bei der Umgehung von AP-Stellen ( Tabelle IV ), wobei bei den NC ssOligos in der rad30Δ Mutante ähnlich der in Wildtyphefe beobachteten (vgl rad30Δ Spalte mit NC-Spalte in Tabelle IV). Zusammengefasst legen diese Daten nahe, dass der eine AP-Stelle umgebende Sequenzkontext einen signifikanten Effekt auf die Fähigkeit dieser Polymerasen ausüben kann, ein Nukleotid über eine AP-Stelle zu inserieren oder zu verlängern.

Wenn Transformanten, die aus der COD-Serie von ssOligos im Wildtyp-Hintergrund stammten, sequenziert wurden, wurde beobachtet, dass dC das bevorzugte Nukleotid war, das gegenüber der AP-Stelle inseriert wurde (Bereich von 52 % bis 66 %, Tabelle V). dA war das am zweithäufigsten inserierte Nukleotid (Bereich von 12% bis 44%, Tabelle V). Die Mutationsspezifität stimmt damit überein, dass REV1 das Hauptenzym ist, das für die Nukleotidinsertion über alle AP-Stellen hinweg unabhängig vom Sequenzkontext verantwortlich ist.

Tabelle V

Auswirkung des Sequenzkontexts auf die Bypass-Spezifität einer AP-Stelle.

Oligonukleotidsequenz a % Nukleotid eingefügt (kein b )
dC dA dG dT
COD(+7)-S764(9)36(5)--
5′--AGBx
    --CAGSCGACCATTAA𠄵′
COD(+7)-S656(10)44(8)--
5′--AGBx
    --CAGASGACCATTAA-5′
COD(+7)-S552(9)12(2)-35(6)
5′--AGBTGx
    --CAGACSACCATTAA-5′
COD(+7)-S464(11)29(5)6(1)6(1)
5′--AGCTGCx
    --CAGACGSCCATTAA-5′
COD(+7)-S360(18)33(10)7(2)-
5′--AGBTGCTx
    --CAGACGASCATTAA-5′
COD(+7)-S266 (14)34 (7)--
5′--GTCTGCTGx
    --CAGACGACSATTAA-5′
COD(+7)-S156(18)38(12)-6(2)
5′--GTCTGCTGGx
    --CAGACGACCSTTAA-5′

Auswirkung der Replikationsrichtung auf die Umgehung der AP-Site

Die Bypass-Effizienzen von AP-Stellen in Wildtyp-Hefe, die mit den COD-ssOligos [COD(+7)-S3, -S4, -S6 und -S7] bestimmt wurden, waren ungefähr zweifach höher als die entsprechenden NC-ssOligos [NC(+7 )-S3, -S4, -S5 und -S7]. COD- und NC-ssOligos hybridisieren an den führenden bzw. den nacheilenden Replikationsstrang in Wildtyp-SJR922 (Tabelle IV).AP-Stellen, die von der COD- und NC-ssOligo-Serie abgeleitet sind, befinden sich daher während der anschließenden Runde der DNA-Synthese auf den Matrizen des nacheilenden und führenden Strangs, und die Umgehung der AP-Stelle wird auf den nacheilenden bzw. führenden Strängen auftreten (siehe Abbildung 2A, Supplemental Daten). Diese Daten legen nahe, dass die Umgehung von AP-Stellen bei der Verzögerung effizienter sein kann als beim führenden Strang der DNA-Replikation. Auch weil wir gezeigt haben, dass die Umgehung einer AP-Stelle signifikant durch den eine AP-Stelle umgebenden Sequenzkontext beeinflusst wird, könnte der Unterschied in der Bypass-Effizienz zwischen den NC- und COD-ssOligos möglicherweise allein auf die Unterschiede im Sequenzkontext, der die AP-Stellen umgibt, zurückzuführen sein . Um direkt zu bestimmen, ob die Umgehung einer gegebenen AP-Stelle durch die Richtung der DNA-Replikation beeinflusst wird, wurde die Umgehung von AP-Stellen in zwei Hefestämmen, SJR1454 und SJR1141, unter Verwendung der gleichen ssOligos (Tabelle VI) durchgeführt. In SJR1141 ist die LYS2 Gen wurde relativ zum stromaufwärts gelegenen Replikationsursprung invertiert, was die Identität der führenden und nacheilenden Stränge umkehrt. Denn das Umdrehen des LYS2 Gen führte auch zur Inaktivierung von RAD16 Gen, a rad16Δ Derivat von SJR922 (SJR1454) wurde in diesen Experimenten verwendet. Somit annealt NC ssOligos an die führenden und nacheilenden Stränge von LYS2 in SJR1141 bzw. SJR1454, und die Umgehung einer AP-Stelle in diesen Stämmen erfolgt an nacheilenden bzw. führenden Strängen ( 2B , Ergänzende Daten). Obwohl unsere früheren Daten zeigten, dass die Hefetransformation durch einzelsträngige Oligonukleotide signifikant effizienter ist, wenn das Oligonukleotid an den nachlaufenden Strang hybridisiert ([22] siehe auch Tabelle II, Ergänzende Daten), werden die Unterschiede in der Transformationseffizienz des führenden und des nachlaufenden Strangs korrigiert wenn die Bypass-Effizienz von AP-Stellen gegen Oligonukleotide normalisiert wird, die keine AP-Stellen enthalten (siehe Tabelle II für die Berechnung der Bypass-Effizienz). Tabelle VI zeigt, dass die Bypass-Effizienz von AP-Stellen, die mit NC ssOligos NC(+7)-S4, NC(+7)-S5 und NC(+7)-S6 beobachtet wurden, in SJR1141 im Vergleich zu SJR1454 zweifach höher zu sein scheint, und bei anderen ssOligos wurden keine signifikanten Unterschiede in der Bypass-Effizienz beobachtet, daher ist es wahrscheinlich, dass der Bypass von AP-Stellen nicht durch die Richtung der DNA-Replikation beeinflusst wird. Diese Beobachtung steht im Einklang mit den jüngsten Beobachtungen von Pages et al.[18].

Tabelle VI

Bypass der AP-Stelle im führenden und nacheilenden Strang.

SJR1141 Führungsstrang a % Bypass c SJR1454 Nacheilender Strang b % Bypass c
Öffner(+7)-S126,1 ± 7,1Öffner(+7)-S120,3 ± 5,7
Öffner(+7)-S237,9 ± 11,0Öffner(+7)-S241,6 ± 14,4
Öffner(+7)-S339,2 ± 2,3Öffner(+7)-S337,9 ± 12,9
Öffner(+7)-S462,8 ± 17,9Öffner(+7)-S446,2 ± 16,1
Öffner(+7)-S559,5 ± 15,4Öffner(+7)-S524,9 ± 5,9
Öffner(+7)-S633,2 ± 8,6Öffner(+7)-S618,7 ± 10,2
Öffner(+7)-S713,2 ± 0,6Öffner(+7)-S79,0 ± 0,6

Danksagung

Wir danken Takeshi Shimizu für Vorschläge und chemische Synthese Tomomi Sekine, Akiko Okano und Motoko Uchida für technische Unterstützung Tamio Saito und Hiroyuki Hirano für die Bereitstellung von Verbindungen Siro Simizu für den Aufbau der GLORIA-Bibliothek Toshihiko Nogawa, Shunji Takahashi und Nobumoto Watanabe für Vorschläge. Diese Arbeit wurde vom RIKEN SPDR-Programm (an T.K.), JSPS KAKENHI und dem Wissenschafts- und Technologieforschungsförderungsprogramm für Land- und Forstwirtschaft, Fischerei und Lebensmittelindustrie unterstützt.